G328764



Basic Information


Item Value
gene id G328764
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 18718960 ~ 18719250 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU372168
gggatctccttgtctcatcgcgcaccagcgactcttgtggcgggccgggcgcagtgcgcgctagccaaggttgccaggtgcacggtgtagcctccgacacattggtgcggctggcttccgggttggatgcgcgctgtgttaagaagcagtacggctggttgggttgtgtatcggaggacgcatgacattcagccttcgtctctcccgagcccgtatgggagttgtagcaatgagacaagatagtagctactacaacaattggataccacgaaattggggagaaaaaggggt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU372168 True 291 lncRNA 0.57 1 18718960 18719250

Neighbor


gene id symbol gene type direction distance location
LOC110522239 cited2 coding downstream 168379 18547787 ~ 18550581 (-)
LOC110522238 LOC100194707 coding downstream 173354 18523675 ~ 18545606 (-)
LOC110522236 LOC106607814 coding downstream 221723 18473614 ~ 18497237 (-)
LOC110522235 LOC106607813 coding downstream 275238 18427318 ~ 18443722 (-)
esco2 esco2 coding downstream 322534 18391944 ~ 18396426 (-)
LOC110522240 LOC106607916 coding upstream 82042 18801292 ~ 18812642 (-)
LOC110520976 LOC106607917 coding upstream 245140 18964390 ~ 18978387 (-)
LOC110522245 hivep2 coding upstream 300741 19019991 ~ 19119788 (-)
LOC110520978 batf3 coding upstream 522609 19241859 ~ 19243094 (-)
LOC110522252 LOC106607829 coding upstream 608897 19328013 ~ 19453370 (-)
G328399 NA non-coding downstream 35534 18683131 ~ 18683426 (-)
G328386 NA non-coding downstream 47654 18671096 ~ 18671306 (-)
G328375 NA non-coding downstream 56524 18662162 ~ 18662436 (-)
G328184 NA non-coding downstream 191906 18510053 ~ 18527054 (-)
G328223 NA non-coding downstream 245533 18472787 ~ 18473427 (-)
G328777 NA non-coding upstream 20406 18739656 ~ 18739937 (-)
G328792 NA non-coding upstream 40014 18759264 ~ 18759837 (-)
G328793 NA non-coding upstream 42024 18761274 ~ 18761551 (-)
G328796 NA non-coding upstream 48788 18768038 ~ 18768249 (-)
G328808 NA non-coding upstream 61555 18780805 ~ 18781037 (-)
G328236 NA other downstream 271930 18446583 ~ 18447030 (-)
LOC110522229 LOC106607809 other downstream 433550 18022013 ~ 18286490 (-)
G327409 LOC106607793 other downstream 918491 17795190 ~ 17800469 (-)
vgll2a LOC106607788 other downstream 1152813 17559268 ~ 17566213 (-)
G325960 LOC106607776 other downstream 2056079 16646755 ~ 16662881 (-)
G328760 NA other upstream 75856 18795022 ~ 18862375 (-)
G329663 LOC106607828 other upstream 561888 19281138 ~ 19281481 (-)
G329681 NA other upstream 591843 19311093 ~ 19318679 (-)
LOC110522258 LOC106607836 other upstream 974314 19678324 ~ 19728627 (-)
rcan2 LOC106607629 other upstream 1561876 20166436 ~ 20286886 (-)

Expression


G328764 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G328764 Expression in each Bioproject

Bar chart with 21 bars.
G328764 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network