G328792



Basic Information


Item Value
gene id G328792
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 18759264 ~ 18759837 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU372196
attttacctttatttaaccaggtaggcaagttgagaacaagttctcatttacaattacgacctggccaagataaagcaaagcagtttgacacatacaacgacacagagttacacatggagtaagacaaacatacagtcaataatacagtataaacaagtctatatacaatgtgagcaaatgaggtgagaagggaggtaaaggcaaaaaagtccatggtggcaaggtaaatacaatatagcaagtaaaacactggaatggtagttttgcaatggaagaatgtgcaaagtagaaataaaaataatggggtgcaaaggagcaaaataaataaattaattaaatacagttgggaaagaggtagttgtttgggctaaattataggtgggctatgtacaggtgcagtaatctgtgagctgctctgacagttggtgcttaaagctagtgagggagataagtgattccagtttcagagatttttgtagttcgttccagtcattggcagcagagaactggaaagagaggcggccaaagaaagaattggttttgggggtgactagagagatatacctgctggag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU372196 True 574 lncRNA 0.39 1 18759264 18759837

Neighbor


gene id symbol gene type direction distance location
LOC110522239 cited2 coding downstream 208683 18547787 ~ 18550581 (-)
LOC110522238 LOC100194707 coding downstream 213658 18523675 ~ 18545606 (-)
LOC110522236 LOC106607814 coding downstream 262027 18473614 ~ 18497237 (-)
LOC110522235 LOC106607813 coding downstream 315542 18427318 ~ 18443722 (-)
esco2 esco2 coding downstream 362838 18391944 ~ 18396426 (-)
LOC110522240 LOC106607916 coding upstream 41455 18801292 ~ 18812642 (-)
LOC110520976 LOC106607917 coding upstream 204553 18964390 ~ 18978387 (-)
LOC110522245 hivep2 coding upstream 260154 19019991 ~ 19119788 (-)
LOC110520978 batf3 coding upstream 482022 19241859 ~ 19243094 (-)
LOC110522252 LOC106607829 coding upstream 568310 19328013 ~ 19453370 (-)
G328777 NA non-coding downstream 19327 18739656 ~ 18739937 (-)
G328764 NA non-coding downstream 40014 18718960 ~ 18719250 (-)
G328399 NA non-coding downstream 75838 18683131 ~ 18683426 (-)
G328386 NA non-coding downstream 87958 18671096 ~ 18671306 (-)
G328375 NA non-coding downstream 96828 18662162 ~ 18662436 (-)
G328793 NA non-coding upstream 1437 18761274 ~ 18761551 (-)
G328796 NA non-coding upstream 8201 18768038 ~ 18768249 (-)
G328808 NA non-coding upstream 20968 18780805 ~ 18781037 (-)
G328761 NA non-coding upstream 32622 18792459 ~ 18796350 (-)
G328760 NA non-coding upstream 35185 18795022 ~ 18862375 (-)
G328236 NA other downstream 312234 18446583 ~ 18447030 (-)
LOC110522229 LOC106607809 other downstream 473854 18022013 ~ 18286490 (-)
G327409 LOC106607793 other downstream 958795 17795190 ~ 17800469 (-)
vgll2a LOC106607788 other downstream 1193117 17559268 ~ 17566213 (-)
G325960 LOC106607776 other downstream 2096383 16646755 ~ 16662881 (-)
G329663 LOC106607828 other upstream 521301 19281138 ~ 19281481 (-)
G329681 NA other upstream 551256 19311093 ~ 19318679 (-)
LOC110522258 LOC106607836 other upstream 933727 19678324 ~ 19728627 (-)
rcan2 LOC106607629 other upstream 1521289 20166436 ~ 20286886 (-)

Expression


G328792 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G328792 Expression in each Bioproject

Bar chart with 18 bars.
G328792 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network