G329280



Basic Information


Item Value
gene id G329280
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 19574724 ~ 19629202 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU372727
ccaaaattgaactttttggcaacaatgcaaaactttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcgtcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaacctgatggacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaataatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU372727 True 327 lncRNA 0.43 2 19574724 19629202
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522254 NA coding upstream 86437 19485025 ~ 19488287 (+)
LOC110522253 LOC106607831 coding upstream 91862 19455002 ~ 19482862 (+)
LOC110522251 LOC106607828 coding upstream 265764 19269334 ~ 19308960 (+)
LOC110522250 LOC106607827 coding upstream 307560 19258560 ~ 19268556 (+)
LOC110522249 LOC106607825 coding upstream 342571 19228302 ~ 19232153 (+)
LOC110522257 LOC106607835 coding downstream 11307 19640509 ~ 19675856 (+)
LOC118964443 NA coding downstream 83917 19713119 ~ 19724642 (+)
LOC110522261 znf512 coding downstream 172009 19801211 ~ 19811868 (+)
gtf3c2 gtf3c2 coding downstream 182817 19812019 ~ 19833998 (+)
si:ch211-243j20.2 uckl1 coding downstream 238969 19868171 ~ 19895332 (+)
G329213 NA non-coding upstream 97595 19476279 ~ 19477129 (+)
G329124 NA non-coding upstream 245881 19328000 ~ 19328843 (+)
G328697 NA non-coding upstream 323654 19250244 ~ 19251070 (+)
G329345 NA non-coding downstream 53891 19683093 ~ 19684859 (+)
G329287 LOC106607836 non-coding downstream 74077 19703279 ~ 19725455 (+)
G329359 NA non-coding downstream 123645 19752847 ~ 19767352 (+)
G329473 NA non-coding downstream 321979 19951181 ~ 19953918 (+)
G329493 NA non-coding downstream 359192 19988394 ~ 19988932 (+)
LOC110522244 LOC106607820 other upstream 645647 18882852 ~ 18952184 (+)
G328446 LOC106607916 other upstream 767920 18794581 ~ 18806804 (+)
G328474 NA other upstream 817179 18756855 ~ 18757545 (+)
G329556 NA other downstream 468154 20097356 ~ 20100056 (+)
G329626 NA other downstream 623565 20252767 ~ 20253911 (+)
G330771 NA other downstream 1191466 20820668 ~ 20821157 (+)
LOC110522308 LOC106607893 other downstream 2054732 21683716 ~ 21701617 (+)
G332458 LOC106584613 other downstream 2869298 22498500 ~ 22498996 (+)

Expression


G329280 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G329280 Expression in each Bioproject

Bar chart with 19 bars.
G329280 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network