G330771


Basic Information

Item Value
gene id G330771
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 20820668 ~ 20821157 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU374473
gtcaatgatgtcctgagagacatgctgaacatctttgttttcgtttaccttgacgatatcctgattttttcaccgtcactccagattcatgttcagcacgttcgacgtgtcctccagcgccttttagagaattgtcttttcgtgaaggctgagaagtgcacttttcatgcctcctccgtcacatttctcggttctgttatttccgctgaaggcattaagatggatcccgctaaggtccaagctgtcattgattggcccgtccctaagtcacgtgtcgagctgcagcgctttctcggcttcgcgaacttctatcgtcgtttcatccgtaatttcggtcaggtggcagctcctctcacagcccttacttctgtcaagacgtgctttaagtggtccgtttccgcccagggagcttttgatctcctcaagaatcgttttacatccgctcctatccttgttacacctgacgtctctagacagttcgttgtcgagg

Function

NR:

description
PREDICTED: retrotransposon-like protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU374473 True 490 TUCP 0.49 1 20820668 20821157

Neighbor

gene id symbol gene type direction distance location
LOC110522283 LOC106607866 coding upstream 132242 20683325 ~ 20688426 (+)
LOC110522282 LOC106607865 coding upstream 153404 20654965 ~ 20667264 (+)
LOC110521055 enah coding upstream 168780 20493498 ~ 20651888 (+)
LOC110522277 LOC106607858 coding upstream 348853 20433774 ~ 20471815 (+)
LOC118964445 NA coding upstream 388945 20427893 ~ 20431723 (+)
LOC110522285 LOC106607868 coding downstream 102360 20923517 ~ 20957715 (+)
LOC110522289 LOC106607875 coding downstream 351127 21172284 ~ 21204980 (+)
LOC110522290 LOC106607876 coding downstream 394032 21215189 ~ 21227523 (+)
LOC110522292 LOC106607878 coding downstream 434853 21256010 ~ 21272228 (+)
LOC110522291 LOC106607878 coding downstream 451116 21272273 ~ 21283854 (+)
G330756 NA non-coding upstream 9608 20810836 ~ 20811060 (+)
G330750 NA non-coding upstream 12492 20807930 ~ 20808176 (+)
G330397 NA non-coding upstream 52995 20672705 ~ 20767673 (+)
G330452 NA non-coding upstream 58939 20758475 ~ 20761729 (+)
G330271 NA non-coding upstream 383804 20436597 ~ 20436864 (+)
G330797 NA non-coding downstream 18721 20839878 ~ 20840185 (+)
G330822 NA non-coding downstream 34712 20855869 ~ 20871276 (+)
G330919 NA non-coding downstream 99267 20920424 ~ 20920653 (+)
G330993 NA non-coding downstream 154587 20975744 ~ 20976001 (+)
G329626 NA other upstream 566757 20252767 ~ 20253911 (+)
G329556 NA other upstream 720612 20097356 ~ 20100056 (+)
LOC110522251 LOC106607828 other upstream 1550143 19269334 ~ 19308960 (+)
LOC110522250 LOC106607827 other upstream 1552112 19258560 ~ 19268556 (+)
LOC110522244 LOC106607820 other upstream 1891591 18882852 ~ 18952184 (+)
LOC110522308 LOC106607893 other downstream 862777 21683716 ~ 21701617 (+)
G332458 LOC106584613 other downstream 1677343 22498500 ~ 22498996 (+)
G332507 NA other downstream 1771773 22592930 ~ 22593362 (+)
G333079 smyd2 other downstream 2134722 22955879 ~ 22958196 (+)
ccdc167 ccdc167 other downstream 2924672 23745535 ~ 23748393 (+)

Expression

G330771 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G330771 Expression in each Bioproject

Bar chart with 19 bars.
G330771 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network