G332554



Basic Information


Item Value
gene id G332554
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 22712134 ~ 22712395 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU376460
ttggatgatccagaagaagattgggagaatgtcatatggtcagatgaaaccaaaatataactttttggtaaaaactcaacttgttgtgtttggaggacaaagaatgctgagttgcatccaaagaacaccatacctactgtgaagcatgggagtggaaacatcatgctttgggaatgtttttctgcaaagggaccaggacgactgatccgtgtaaaggaaagaatgaatggggccatgtatcgtgagattttgagtgaaaacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU376460 True 262 lncRNA 0.41 1 22712134 22712395

Neighbor


gene id symbol gene type direction distance location
LOC110522345 LOC106607930 coding upstream 5625 22696828 ~ 22706509 (+)
LOC110522344 LOC106607931 coding upstream 18791 22684894 ~ 22693343 (+)
LOC110522342 LOC106607951 coding upstream 29821 22674306 ~ 22682313 (+)
ctsbb LOC100135964 coding upstream 48080 22659190 ~ 22664054 (+)
fdft1 fdft1 coding upstream 60791 22638302 ~ 22651343 (+)
LOC110522347 LOC106607950 coding downstream 101888 22814283 ~ 22849434 (+)
LOC110522349 ptpn14 coding downstream 141028 22853423 ~ 22955428 (+)
LOC118964451 NA coding downstream 395453 23107820 ~ 23113334 (+)
snx9b snx9 coding downstream 612043 23324438 ~ 23357018 (+)
LOC100136772 LOC100136772 coding downstream 669797 23382192 ~ 23388570 (+)
G332521 NA non-coding upstream 75446 22634097 ~ 22636688 (+)
G332511 NA non-coding upstream 110882 22601040 ~ 22601252 (+)
G332227 NA non-coding upstream 156816 22552453 ~ 22555318 (+)
G332485 NA non-coding upstream 163403 22547536 ~ 22548731 (+)
G332474 NA non-coding upstream 181055 22530782 ~ 22531079 (+)
G332567 NA non-coding downstream 16684 22729079 ~ 22729699 (+)
G332576 NA non-coding downstream 32408 22744803 ~ 22745029 (+)
G332594 kcnk2 non-coding downstream 55194 22767589 ~ 22767904 (+)
G333028 NA non-coding downstream 74106 22786501 ~ 22786702 (+)
G333031 NA non-coding downstream 76672 22789067 ~ 22789294 (+)
G332507 NA other upstream 118772 22592930 ~ 22593362 (+)
G332458 LOC106584613 other upstream 213138 22498500 ~ 22498996 (+)
LOC110522308 LOC106607893 other upstream 1010520 21683716 ~ 21701617 (+)
G330771 NA other upstream 1890977 20820668 ~ 20821157 (+)
G329626 NA other upstream 2458223 20252767 ~ 20253911 (+)
G333079 smyd2 other downstream 243484 22955879 ~ 22958196 (+)
ccdc167 ccdc167 other downstream 1033434 23745535 ~ 23748393 (+)
G334116 NA other downstream 1121426 23833821 ~ 23837875 (+)
si:ch211-51e12.7 NA other downstream 1351436 24063831 ~ 24072963 (+)
G334475 NA other downstream 1705187 24417582 ~ 24418946 (+)

Expression


G332554 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G332554 Expression in each Bioproject

Bar chart with 15 bars.
G332554 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network