G333474



Basic Information


Item Value
gene id G333474
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 23637279 ~ 23637627 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU377504
taatataatacatcaataaaatcaatttagcctcaagtaaataatgaaacatgttaaatttggtttaaataatgcaaaaacaaagtgttggagaagaaagtaaaagtgcaatatgtgctaagtaagaaagctaacatttcagttccttgctcagaacatgagaacatatgaaatgttccttttaacatgagtcttcaatattcccaggtaagaagctttaggttgtagttattataggaattataggactatttccctctataccatttgtatttcattaacctttgactattagatgttcttataggcactttagtattgccagtgtaaaagtatagcttccgtccct

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU377504 True 349 lncRNA 0.30 1 23637279 23637627

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc-7 NA coding upstream 86449 23550757 ~ 23550830 (+)
LOC110522421 LOC106608030 coding upstream 99126 23529912 ~ 23538153 (+)
lin9 LOC106608031 coding upstream 111754 23509072 ~ 23525525 (+)
parp1 parp1 coding upstream 130712 23494771 ~ 23506567 (+)
LOC118964414 NA coding upstream 145516 23489022 ~ 23491763 (+)
ccdc167 ccdc167 coding downstream 107908 23745535 ~ 23748393 (+)
LOC110522416 NA coding downstream 130862 23768487 ~ 23772991 (+)
si:ch211-225h24.2 tdrp coding downstream 140984 23778611 ~ 23801507 (+)
acp1 NA coding downstream 229113 23866740 ~ 23879587 (+)
LOC110522408 LOC106608020 coding downstream 387307 24024934 ~ 24034274 (+)
G333466 NA non-coding upstream 9944 23627096 ~ 23627335 (+)
G333464 NA non-coding upstream 16762 23620096 ~ 23620517 (+)
G333452 NA non-coding upstream 40633 23596429 ~ 23596646 (+)
G333447 NA non-coding upstream 50786 23586218 ~ 23586493 (+)
G333399 NA non-coding upstream 153212 23483828 ~ 23484067 (+)
G333475 NA non-coding downstream 457 23638084 ~ 23638344 (+)
G333477 NA non-coding downstream 4464 23642091 ~ 23642446 (+)
G333479 NA non-coding downstream 6477 23644104 ~ 23644314 (+)
G333481 NA non-coding downstream 7473 23645100 ~ 23645684 (+)
G333482 NA non-coding downstream 8532 23646159 ~ 23646451 (+)
G333079 smyd2 other upstream 679083 22955879 ~ 22958196 (+)
G332507 NA other upstream 1043917 22592930 ~ 22593362 (+)
G332458 LOC106584613 other upstream 1138283 22498500 ~ 22498996 (+)
LOC110522308 LOC106607893 other upstream 1935665 21683716 ~ 21701617 (+)
G330771 NA other upstream 2816122 20820668 ~ 20821157 (+)
G334116 NA other downstream 196194 23833821 ~ 23837875 (+)
si:ch211-51e12.7 NA other downstream 426204 24063831 ~ 24072963 (+)
G334475 NA other downstream 779955 24417582 ~ 24418946 (+)
G334473 armt1 other downstream 782487 24420114 ~ 24422731 (+)

Expression


G333474 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G333474 Expression in each Bioproject

Bar chart with 17 bars.
G333474 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network