G334252



Basic Information


Item Value
gene id G334252
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 23938272 ~ 23939369 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU378351
ggatttatcagtggtgacagtgtttcctatcttcagtgcagtgggcagctgggaggaggtgttcttattctccatggactttacggtgtcccagaacttttttgagttagtgttgcaagaagcaaatttctgcttgaaaaagctagccttggcttttctaactgcctgtgtataatggtttctagcttccctgaacagctgcatatcacgggggctgttcgatgctaatgcagaacgccataggatgtttttgtgttggttaagggcagtcaggtctggggagaaccaagggctatatctgttcctggttctaaatttcttgaatggggcatgtttatttaagatggttaggaaggcattttttaaaaatatccaggcatcctctactgacgggatgaggtcaatatccttccaggataccccggccaggtcgattagaaaggcctgctcgctgaagtgtttcagggagcgttttacagtgatgagaggaggtcgtttgaccgctgacccattacggatgcaggcaatgaggcagtgatcgctgagatcttggttgaagacagcagaggtgtatttagaggggaagttggttaggatgatatctatgagggtgcccgtgtttaaggctttggggaggtacctggtaggttcattgataatttgtgtgagattgagggcatcaagtttagattgtaggatggctggggtgttaagcatgttccagtttaggtcgcctagcagcacgagctctgaagatagatggggggcaatcagttcacatatggtgtccagagcacagctgggggcagagggtggtctatagcaagcggcaacggtgagagacttgtttttagagaggtggatttttaaaagtagaagttcaaattgtttgggtacagacctggatagtaggacagaactctgcaggctatctttgcagtagattacaacaccgccccctttggcagttctatcttgtctgaaaatgttgtagtttggaattaaaatgtctgaatttttggtggtcttcctaagccaggattcagacacagctagaacatccgggttggcagagtgtgctaaagcagtgaatagaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU378351 True 1098 TUCP 0.46 1 23938272 23939369

Neighbor


gene id symbol gene type direction distance location
LOC110522411 fam150b coding downstream 51298 23883345 ~ 23886974 (-)
fam110c NA coding downstream 100387 23835949 ~ 23837885 (-)
fbxo25 fbxo25 coding downstream 119738 23801281 ~ 23818534 (-)
cmtr1 cmtr1 coding downstream 173197 23748635 ~ 23765075 (-)
kif25 kif25 coding downstream 192046 23732713 ~ 23746226 (-)
LOC118964396 NA coding upstream 28246 23967615 ~ 23975633 (-)
tmem18 tmem18 coding upstream 69371 24008740 ~ 24010610 (-)
si:dkey-119f1.1 smc6 coding upstream 94784 24034153 ~ 24052516 (-)
LOC118964452 NA coding upstream 135465 24074834 ~ 24075889 (-)
mrps10 mrps10 coding upstream 136798 24076167 ~ 24081797 (-)
G334244 NA non-coding downstream 7018 23930906 ~ 23931254 (-)
G334230 NA non-coding downstream 32467 23901112 ~ 23905805 (-)
G334215 NA non-coding downstream 68709 23868154 ~ 23869563 (-)
G334194 NA non-coding downstream 103959 23833779 ~ 23834313 (-)
G334183 NA non-coding downstream 112109 23825822 ~ 23826163 (-)
G334819 NA non-coding upstream 74700 24014069 ~ 24014303 (-)
G334820 NA non-coding upstream 75268 24014637 ~ 24014972 (-)
G334818 NA non-coding upstream 124543 24063912 ~ 24067435 (-)
G334859 NA non-coding upstream 153598 24092967 ~ 24093437 (-)
G334869 NA non-coding upstream 171065 24110434 ~ 24111535 (-)
G333842 LOC100136772 other downstream 549702 23387061 ~ 23388570 (-)
LOC110522343 LOC106607932 other downstream 1274365 22659885 ~ 22674233 (-)
G332867 pol3 other downstream 1440543 22496923 ~ 22497729 (-)
G332823 NA other downstream 1520363 22417282 ~ 22417909 (-)
LOC110521061 LOC106607946 other downstream 1672791 22262381 ~ 22265570 (-)
G334789 NA other upstream 79103 24018472 ~ 24024503 (-)
G337147 LOC106607991 other upstream 1571141 25510510 ~ 25512780 (-)
G337207 NA other upstream 1694348 25633717 ~ 25634063 (-)
G337894 NA other upstream 2828005 26767374 ~ 26770165 (-)
LOC110522434 fkbp1b other upstream 3791039 27730407 ~ 27757242 (-)

Expression


G334252 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G334252 Expression in each Bioproject

Bar chart with 20 bars.
G334252 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network