G334312



Basic Information


Item Value
gene id G334312
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 24016737 ~ 24017204 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU378413
gagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgcttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttctcccacatgtttggtgtgtctcccaggtggcttgtgg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU378413 True 468 lncRNA 0.44 1 24016737 24017204
Loading

Neighbor


gene id symbol gene type direction distance location
acp1 NA coding upstream 137150 23866740 ~ 23879587 (+)
si:ch211-225h24.2 tdrp coding upstream 215230 23778611 ~ 23801507 (+)
LOC110522416 NA coding upstream 245733 23768487 ~ 23772991 (+)
ccdc167 ccdc167 coding upstream 268344 23745535 ~ 23748393 (+)
trnaa-ugc-7 NA coding upstream 465907 23550757 ~ 23550830 (+)
LOC110522408 LOC106608020 coding downstream 7730 24024934 ~ 24034274 (+)
LOC110522407 gen1 coding downstream 35344 24052548 ~ 24060425 (+)
msgn1 LOC106608038 coding downstream 44473 24061677 ~ 24063116 (+)
si:ch211-51e12.7 NA coding downstream 46627 24063831 ~ 24072963 (+)
tulp4a tulp4 coding downstream 65651 24082855 ~ 24138549 (+)
G334311 NA non-coding upstream 2852 24013668 ~ 24013885 (+)
G334162 NA non-coding upstream 85481 23930888 ~ 23931256 (+)
G334133 NA non-coding upstream 157376 23859068 ~ 23859361 (+)
G334132 NA non-coding upstream 158924 23857555 ~ 23857813 (+)
G334116 NA non-coding upstream 178862 23833821 ~ 23837875 (+)
G334313 cssa06h1orf115 non-coding downstream 1285 24018489 ~ 24024491 (+)
G334325 NA non-coding downstream 34507 24051711 ~ 24052073 (+)
G334369 serac1 non-coding downstream 138517 24155721 ~ 24159410 (+)
G333079 smyd2 other upstream 1058541 22955879 ~ 22958196 (+)
G332507 NA other upstream 1423375 22592930 ~ 22593362 (+)
G332458 LOC106584613 other upstream 1517741 22498500 ~ 22498996 (+)
G334475 NA other downstream 400378 24417582 ~ 24418946 (+)
G334473 armt1 other downstream 402910 24420114 ~ 24422731 (+)
LOC110522376 sash1 other downstream 2033849 25761890 ~ 26057813 (+)
G336464 NA other downstream 2875931 26892229 ~ 26894837 (+)

Expression


G334312 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G334312 Expression in each Bioproject

Bar chart with 20 bars.
G334312 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network