G334441



Basic Information


Item Value
gene id G334441
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 24300896 ~ 24348001 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU378575
cccaggtggcttgtggcaaactttaaacgacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatggatcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccagg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU378575 True 238 lncRNA 0.45 2 24300896 24348001
Loading

Neighbor


gene id symbol gene type direction distance location
tmem181 tmem181 coding upstream 152559 24138959 ~ 24148337 (+)
tulp4a tulp4 coding upstream 162347 24082855 ~ 24138549 (+)
si:ch211-51e12.7 NA coding upstream 227933 24063831 ~ 24072963 (+)
msgn1 LOC106608038 coding upstream 237780 24061677 ~ 24063116 (+)
LOC110522407 gen1 coding upstream 240471 24052548 ~ 24060425 (+)
zbtb2b zbtb2 coding downstream 86134 24434135 ~ 24443445 (+)
trnal-uaa NA coding downstream 297223 24645224 ~ 24645306 (+)
utrn LOC106608002 coding downstream 300024 24648025 ~ 24989137 (+)
LOC118964455 NA coding downstream 754793 25102794 ~ 25104074 (+)
LOC110522385 LOC106607999 coding downstream 758187 25106188 ~ 25127317 (+)
G334417 NA non-coding upstream 34222 24266013 ~ 24266674 (+)
G334414 NA non-coding upstream 44610 24255510 ~ 24256286 (+)
G334375 NA non-coding upstream 117270 24166451 ~ 24183626 (+)
G334369 serac1 non-coding upstream 141486 24155721 ~ 24159410 (+)
G334455 NA non-coding downstream 1691 24349692 ~ 24350448 (+)
G334470 NA non-coding downstream 60922 24408923 ~ 24412772 (+)
G334482 NA non-coding downstream 85483 24433484 ~ 24433935 (+)
G334483 NA non-coding downstream 87199 24435200 ~ 24435503 (+)
G334116 NA other upstream 466474 23833821 ~ 23837875 (+)
ccdc167 ccdc167 other upstream 552625 23745535 ~ 23748393 (+)
G333079 smyd2 other upstream 1342700 22955879 ~ 22958196 (+)
G332507 NA other upstream 1707534 22592930 ~ 22593362 (+)
G334475 NA other downstream 69581 24417582 ~ 24418946 (+)
G334473 armt1 other downstream 72113 24420114 ~ 24422731 (+)
LOC110522376 sash1 other downstream 1703052 25761890 ~ 26057813 (+)
G336464 NA other downstream 2545134 26892229 ~ 26894837 (+)
LOC110522355 plekhg1 other downstream 2828380 27054628 ~ 27185449 (+)

Expression


G334441 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G334441 Expression in each Bioproject

Bar chart with 16 bars.
G334441 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network