G337157 (yo84)



Basic Information


Item Value
gene id G337157
gene name yo84
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 25530490 ~ 25530847 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU381684
cacttccttatgtctgaaacacatgcttctagcgagggcaattttggggcttcaccatgtttcattgaaatgtacagctgtgtgtcatccgcatagcagtgaaagttaacattatgttttcgaatgacatccccaagaggtaaaatatatagtgaaaacaatagtggtcctaaaacggaaccttgaggaacactgaaatttacagttgatttgtcagaggacaaaccattcacagagacaaactgatatctttccgacagataagatctaaaccaggccagaacttgtccgtgtagaccaatttgggtttccaatctctccaaaagaatgtggtgatcgatggtatcaaaagcagcac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU381684 True 358 lncRNA 0.41 1 25530490 25530847
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522383 LOC106607997 coding downstream 390053 25135585 ~ 25140437 (-)
epm2a epm2a coding downstream 424935 25085911 ~ 25105555 (-)
LOC118964454 NA coding downstream 469780 25028611 ~ 25060710 (-)
LOC110522390 NA coding downstream 886126 24639723 ~ 24644364 (-)
LOC110522391 LOC106608006 coding downstream 901224 24624615 ~ 24629266 (-)
LOC110522375 LOC106607984 coding upstream 655559 26186406 ~ 26211003 (-)
cdc40 cdc40 coding upstream 751761 26282608 ~ 26327662 (-)
LOC110522371 gpr6 coding upstream 951741 26482588 ~ 26484715 (-)
fig4a fig4 coding upstream 967667 26498514 ~ 26603349 (-)
cep57l1 cep57l1 coding upstream 1149810 26680657 ~ 26685611 (-)
G337093 NA non-coding downstream 99175 25430919 ~ 25431315 (-)
G336977 NA non-coding downstream 271157 25259126 ~ 25259333 (-)
G336939 LOC106607995 non-coding downstream 332260 25196125 ~ 25198230 (-)
G335434 NA non-coding downstream 470441 25058439 ~ 25060049 (-)
G335432 NA non-coding downstream 478873 25051317 ~ 25051617 (-)
G337161 NA non-coding upstream 3034 25533881 ~ 25534162 (-)
G337165 NA non-coding upstream 8186 25539033 ~ 25539324 (-)
G337188 NA non-coding upstream 67928 25598775 ~ 25601072 (-)
G337189 NA non-coding upstream 71063 25601910 ~ 25602222 (-)
G337191 NA non-coding upstream 76795 25607642 ~ 25607882 (-)
G337147 LOC106607991 other downstream 17710 25510510 ~ 25512780 (-)
G334789 NA other downstream 1505987 24018472 ~ 24024503 (-)
G334252 NA other downstream 1591121 23938272 ~ 23939369 (-)
G333842 LOC100136772 other downstream 2141920 23387061 ~ 23388570 (-)
LOC110522343 LOC106607932 other downstream 2866583 22659885 ~ 22674233 (-)
G337207 NA other upstream 102870 25633717 ~ 25634063 (-)
G337894 NA other upstream 1236527 26767374 ~ 26770165 (-)
LOC110522434 fkbp1b other upstream 2199561 27730407 ~ 27757242 (-)
G339008 NA other upstream 2391602 27922449 ~ 27923104 (-)
G340468 NA other upstream 3325982 28856829 ~ 28857186 (-)

Expression


G337157(yo84) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 200.
End of interactive chart.

G337157(yo84) Expression in each Bioproject

Bar chart with 20 bars.
G337157(yo84) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6000.
End of interactive chart.

Co-expression Network