G338945



Basic Information


Item Value
gene id G338945
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 27826641 ~ 27827036 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU383603
gtaaaggcaaaaaaggccatggtggcaaagtaaatacaatatagcaagtaaaacactggaatggtagatttgcagtggaagaatgtgcaaagtagaaataaaaataatggggtgcaaaggagcaaaataaataaataaataaaataaatacagtagggaaagaagtagttgtttgggctaaattataggtgggctatgtacaggtgcagtaatctgtgagctgctctgacagttggtgcttaaagctagtgagggagataagtgtttccagtttcagagatgtttgtagttcgttccagtcattggcagcagagaactggaaggagaggcggccaaagaaagaattggttttgggggtgactagagagatatacctgctagagcgtgtgctacagg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU383603 True 396 lncRNA 0.40 1 27826641 27827036

Neighbor


gene id symbol gene type direction distance location
ubxn2a ubxn2a coding downstream 24555 27790693 ~ 27802086 (-)
LOC110522436 LOC106608045 coding downstream 37842 27764840 ~ 27788799 (-)
LOC110522434 fkbp1b coding downstream 69399 27730407 ~ 27757242 (-)
LOC118964458 NA coding downstream 349253 27476532 ~ 27477388 (-)
fam166c cssa06h2orf70 coding downstream 425005 27400616 ~ 27401636 (-)
LOC110522439 klhl29 coding upstream 135669 27962705 ~ 28346199 (-)
trnaa-ugc-8 NA coding upstream 165372 27992408 ~ 27992481 (-)
LOC110522441 LOC106608058 coding upstream 543975 28371011 ~ 28383232 (-)
LOC110522443 LOC100194698 coding upstream 658827 28485863 ~ 28498071 (-)
LOC110522444 LOC106608056 coding upstream 673318 28500354 ~ 28522613 (-)
G338935 NA non-coding downstream 2482 27815003 ~ 27824159 (-)
G338936 NA non-coding downstream 10802 27814861 ~ 27815839 (-)
G338888 NA non-coding downstream 84542 27736817 ~ 27742099 (-)
G338848 mut non-coding downstream 120908 27697136 ~ 27705733 (-)
G338418 NA non-coding downstream 149634 27676770 ~ 27677007 (-)
G338946 NA non-coding upstream 788 27827824 ~ 27828445 (-)
G338948 atad2b non-coding upstream 4655 27831691 ~ 27832089 (-)
G338950 NA non-coding upstream 6067 27833103 ~ 27833781 (-)
G338951 NA non-coding upstream 6870 27833906 ~ 27834165 (-)
G338957 NA non-coding upstream 14568 27841604 ~ 27841819 (-)
G337894 NA other downstream 1056476 26767374 ~ 26770165 (-)
G337207 NA other downstream 2192578 25633717 ~ 25634063 (-)
G337147 LOC106607991 other downstream 2313861 25510510 ~ 25512780 (-)
G334789 NA other downstream 3802138 24018472 ~ 24024503 (-)
G339008 NA other upstream 95413 27922449 ~ 27923104 (-)
G340468 NA other upstream 1029793 28856829 ~ 28857186 (-)
LOC110522449 LOC106571559 other upstream 1418187 29168303 ~ 29300647 (-)
G340879 NA other upstream 1820153 29647189 ~ 29647530 (-)
G341017 NA other upstream 2088626 29915662 ~ 29916190 (-)

Expression


G338945 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G338945 Expression in each Bioproject

Bar chart with 20 bars.
G338945 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network