G341154



Basic Information


Item Value
gene id G341154
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 30174860 ~ 30175258 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU386103
ggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgtagcaaactctatccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacccgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU386103 True 399 lncRNA 0.40 1 30174860 30175258

Neighbor


gene id symbol gene type direction distance location
LOC110522472 rs30 coding upstream 217302 29952461 ~ 29957558 (+)
LOC110522470 prpf39 coding upstream 222733 29942176 ~ 29952127 (+)
LOC110522467 LOC106608085 coding upstream 331950 29838369 ~ 29842910 (+)
LOC110522463 LOC106608087 coding upstream 376720 29787568 ~ 29798140 (+)
LOC110522461 LOC106608092 coding upstream 447659 29717778 ~ 29727201 (+)
LOC110522479 NA coding downstream 620961 30796219 ~ 30797687 (+)
LOC110522477 mgat2 coding downstream 641158 30816416 ~ 30823059 (+)
LOC110522488 hs90a coding downstream 994393 31169651 ~ 31182712 (+)
ppp2r5cb LOC106608134 coding downstream 1011968 31187226 ~ 31227364 (+)
slc25a29 LOC106608124 coding downstream 1216921 31392179 ~ 31401929 (+)
G341152 NA non-coding upstream 149 30174315 ~ 30174711 (+)
G341140 NA non-coding upstream 15841 30158814 ~ 30159019 (+)
G340326 NA non-coding upstream 22162 30093109 ~ 30152698 (+)
G340336 NA non-coding upstream 34378 30105129 ~ 30140482 (+)
G340281 NA non-coding upstream 117772 30014520 ~ 30057088 (+)
G341156 NA non-coding downstream 3310 30178568 ~ 30181303 (+)
G341171 NA non-coding downstream 37949 30213207 ~ 30218211 (+)
G341223 NA non-coding downstream 128536 30303794 ~ 30304006 (+)
G341234 LOC106608081 non-coding downstream 143742 30319000 ~ 30319271 (+)
G341235 NA non-coding downstream 146785 30322043 ~ 30322250 (+)
G339928 NA other upstream 837921 29335369 ~ 29336939 (+)
G339830 LOC100846954 other upstream 1007864 29166518 ~ 29166996 (+)
G339693 NA other upstream 1259321 28914599 ~ 28915539 (+)
G339660 NA other upstream 1315705 28858716 ~ 28859155 (+)
LOC118964415 LOC106608050 other upstream 2573304 27537262 ~ 27601564 (+)
G342538 NA other downstream 1206568 31381826 ~ 31382749 (+)
LOC110522493 LOC106608104 other downstream 1242697 31417955 ~ 31422086 (+)
G342571 NA other downstream 1275875 31451133 ~ 31451476 (+)
G342707 LOC106608120 other downstream 1610607 31785865 ~ 31786206 (+)
G343958 NA other downstream 2519728 32694986 ~ 32704371 (+)

Expression


G341154 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G341154 Expression in each Bioproject

Bar chart with 20 bars.
G341154 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network