G345486



Basic Information


Item Value
gene id G345486
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 34098249 ~ 34098454 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU390931
tccttgagctggctgcccggccaaactgagcaatcggggaagaaggaccttggtcagggaggtgatggtcactctgacagagccccagagttcttctgtggagatggttgtctttctggaaggttctcccatctctgcagccctctaccaatcaggcctttatggtagagtggccagacggaagccactcctaaaaggcacatgac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU390931 True 206 lncRNA 0.55 1 34098249 34098454
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522529 LOC106608176 coding downstream 158016 33749940 ~ 33940233 (-)
zgc:112001 LOC106608178 coding downstream 405891 33690618 ~ 33692358 (-)
LOC110522525 NA coding downstream 455947 33640275 ~ 33643239 (-)
LOC110522520 LOC106608189 coding downstream 507903 33577450 ~ 33590346 (-)
LOC110522518 LOC106608186 coding downstream 521978 33566563 ~ 33576271 (-)
kcnk10a LOC106608174 coding upstream 156538 34254992 ~ 34280216 (-)
LOC110522538 stxb6 coding upstream 331430 34429884 ~ 34436250 (-)
LOC110521086 LOC106608167 coding upstream 342447 34440901 ~ 34455193 (-)
LOC110522539 LOC106608168 coding upstream 360859 34459313 ~ 34463358 (-)
LOC110522542 LOC106608165 coding upstream 376260 34474714 ~ 34478446 (-)
G345472 NA non-coding downstream 13299 34084665 ~ 34084950 (-)
G345440 NA non-coding downstream 36534 34061514 ~ 34061715 (-)
G345438 NA non-coding downstream 37937 34060113 ~ 34060312 (-)
G345434 NA non-coding downstream 39442 34054900 ~ 34058807 (-)
G345339 NA non-coding downstream 171577 33925953 ~ 33926672 (-)
G345737 LOC106608192 non-coding upstream 33377 34131831 ~ 34135822 (-)
G345744 LOC107549545 non-coding upstream 50050 34148504 ~ 34200250 (-)
G345785 NA non-coding upstream 124190 34222644 ~ 34222967 (-)
G345799 NA non-coding upstream 140657 34239111 ~ 34239334 (-)
G345818 NA non-coding upstream 182068 34280522 ~ 34285853 (-)
G345255 LOC106585892 other downstream 308164 33789494 ~ 33790085 (-)
G345248 NA other downstream 317611 33780297 ~ 33780638 (-)
G344164 NA other downstream 1236145 32841256 ~ 32862104 (-)
G343300 antiprot1 other downstream 1974363 32107969 ~ 32123886 (-)
LOC110522548 5nt1a other upstream 703635 34799157 ~ 34807617 (-)
LOC110522550 LOC106571659 other upstream 733985 34832436 ~ 34886570 (-)
LOC110522554 LOC106608208 other upstream 892490 34989546 ~ 35064960 (-)
G346754 NA other upstream 1118870 35217324 ~ 35217782 (-)
G347016 NA other upstream 1453619 35552073 ~ 35552585 (-)

Expression


G345486 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G345486 Expression in each Bioproject

Bar chart with 14 bars.
G345486 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network