G345785



Basic Information


Item Value
gene id G345785
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 34222644 ~ 34222967 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU391285
ccattatttttattcctactttgcacattcttccactgcaaatctaccattccagtgttttacttgctatattggatttactttgccaccatgtcctttttttgcctttacctcccttatctcacctcatttgctcacatcgtatgtagacttgtttctactgtattattgactgtatgtttgttttactccatgtgtaactctgtgtcgttgtatgtgtcgaactgctttgctttatcttggccagttcgcaattgtaaatgagaacttgttctcaacttgcctacctggttaaataaaggtgaaataaataaataaataaaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU391285 True 324 lncRNA 0.35 1 34222644 34222967

Neighbor


gene id symbol gene type direction distance location
LOC110522529 LOC106608176 coding downstream 282411 33749940 ~ 33940233 (-)
zgc:112001 LOC106608178 coding downstream 530286 33690618 ~ 33692358 (-)
LOC110522525 NA coding downstream 580342 33640275 ~ 33643239 (-)
LOC110522520 LOC106608189 coding downstream 632298 33577450 ~ 33590346 (-)
LOC110522518 LOC106608186 coding downstream 646373 33566563 ~ 33576271 (-)
kcnk10a LOC106608174 coding upstream 32025 34254992 ~ 34280216 (-)
LOC110522538 stxb6 coding upstream 206917 34429884 ~ 34436250 (-)
LOC110521086 LOC106608167 coding upstream 217934 34440901 ~ 34455193 (-)
LOC110522539 LOC106608168 coding upstream 236346 34459313 ~ 34463358 (-)
LOC110522542 LOC106608165 coding upstream 251747 34474714 ~ 34478446 (-)
G345744 LOC107549545 non-coding downstream 22394 34148504 ~ 34200250 (-)
G345737 LOC106608192 non-coding downstream 86822 34131831 ~ 34135822 (-)
G345486 NA non-coding downstream 124190 34098249 ~ 34098454 (-)
G345472 NA non-coding downstream 137694 34084665 ~ 34084950 (-)
G345440 NA non-coding downstream 160929 34061514 ~ 34061715 (-)
G345799 NA non-coding upstream 16144 34239111 ~ 34239334 (-)
G345818 NA non-coding upstream 57555 34280522 ~ 34285853 (-)
G345823 NA non-coding upstream 68106 34291073 ~ 34296619 (-)
G345837 NA non-coding upstream 88962 34311929 ~ 34338842 (-)
G345862 NA non-coding upstream 122664 34345631 ~ 34346053 (-)
G345255 LOC106585892 other downstream 432559 33789494 ~ 33790085 (-)
G345248 NA other downstream 442006 33780297 ~ 33780638 (-)
G344164 NA other downstream 1360540 32841256 ~ 32862104 (-)
G343300 antiprot1 other downstream 2098758 32107969 ~ 32123886 (-)
LOC110522548 5nt1a other upstream 579122 34799157 ~ 34807617 (-)
LOC110522550 LOC106571659 other upstream 609472 34832436 ~ 34886570 (-)
LOC110522554 LOC106608208 other upstream 767977 34989546 ~ 35064960 (-)
G346754 NA other upstream 994357 35217324 ~ 35217782 (-)
G347016 NA other upstream 1329106 35552073 ~ 35552585 (-)

Expression


G345785 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G345785 Expression in each Bioproject

Bar chart with 18 bars.
G345785 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network