G346661



Basic Information


Item Value
gene id G346661
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 35008981 ~ 35049139 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU392248
aatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcactcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatatc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU392248 True 383 lncRNA 0.38 2 35008981 35049139
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522554 LOC106608208 coding downstream 16053 34989546 ~ 35064960 (-)
LOC118964469 NA coding downstream 106854 34901023 ~ 34902127 (-)
LOC110522550 LOC106571659 coding downstream 122411 34832436 ~ 34886570 (-)
LOC110522548 5nt1a coding downstream 201364 34799157 ~ 34807617 (-)
LOC110522547 5nt1a coding downstream 224657 34731546 ~ 34784324 (-)
LOC110521088 p4hb coding upstream 268613 35317752 ~ 35326364 (-)
LOC110522556 LOC106608215 coding upstream 712273 35761412 ~ 35769811 (-)
LOC110522557 LOC106608217 coding upstream 722917 35772056 ~ 35800279 (-)
LOC110522561 LOC102778633 coding upstream 806824 35855963 ~ 35882276 (-)
LOC110522560 LOC106608224 coding upstream 836775 35885914 ~ 35895760 (-)
G346651 NA non-coding downstream 21003 34987310 ~ 34987978 (-)
G346565 NA non-coding downstream 34682 34972792 ~ 34974299 (-)
G346639 NA non-coding downstream 47169 34961194 ~ 34961812 (-)
G346633 NA non-coding downstream 57268 34951222 ~ 34951713 (-)
G346604 NA non-coding downstream 102372 34906104 ~ 34906609 (-)
G346716 NA non-coding upstream 73923 35123062 ~ 35123264 (-)
G346728 NA non-coding upstream 110911 35160050 ~ 35160309 (-)
G346740 NA non-coding upstream 143039 35192178 ~ 35192529 (-)
G346765 NA non-coding upstream 183882 35233021 ~ 35233655 (-)
G346797 NA non-coding upstream 240308 35289447 ~ 35289743 (-)
G345255 LOC106585892 other downstream 1218896 33789494 ~ 33790085 (-)
G345248 NA other downstream 1228343 33780297 ~ 33780638 (-)
G346754 NA other upstream 168185 35217324 ~ 35217782 (-)
G347016 NA other upstream 502934 35552073 ~ 35552585 (-)
G347456 NA other upstream 835408 35884547 ~ 35884910 (-)
G349765 NA other upstream 3166740 38215879 ~ 38216887 (-)
G350352 LOC106608159 other upstream 3835213 38884352 ~ 38885882 (-)

Expression


G346661 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G346661 Expression in each Bioproject

Bar chart with 16 bars.
G346661 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network