G346728



Basic Information


Item Value
gene id G346728
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 35160050 ~ 35160309 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU392321
gacttctgttggcatgtcttgtggggtatgcatgggtatctgagctgtgtgttagttgtttaaacagacctctggtggcatgtattgtggggtatgcatgggtatcagagctgtgtgctagtagtttaaacagacctctggtggcatgtcttgtggggtatgcatgggtatcagagctgtgtgctagtagtttaaacagacctctggtggcatgtcttgtggggtatgcatgggtatcagagctgtgtgctagtagttta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU392321 True 260 lncRNA 0.47 1 35160050 35160309
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522554 LOC106608208 coding downstream 167122 34989546 ~ 35064960 (-)
LOC118964469 NA coding downstream 257923 34901023 ~ 34902127 (-)
LOC110522550 LOC106571659 coding downstream 273480 34832436 ~ 34886570 (-)
LOC110522548 5nt1a coding downstream 352433 34799157 ~ 34807617 (-)
LOC118964468 5nt1a coding downstream 377421 34761788 ~ 34782629 (-)
LOC110521088 p4hb coding upstream 157443 35317752 ~ 35326364 (-)
LOC110522556 LOC106608215 coding upstream 601103 35761412 ~ 35769811 (-)
LOC110522557 LOC106608217 coding upstream 611747 35772056 ~ 35800279 (-)
LOC110522561 LOC102778633 coding upstream 695654 35855963 ~ 35882276 (-)
LOC110522560 LOC106608224 coding upstream 725605 35885914 ~ 35895760 (-)
G346716 NA non-coding downstream 36786 35123062 ~ 35123264 (-)
G346661 NA non-coding downstream 110911 35008981 ~ 35049139 (-)
G346651 NA non-coding downstream 172072 34987310 ~ 34987978 (-)
G346565 NA non-coding downstream 185751 34972792 ~ 34974299 (-)
G346740 NA non-coding upstream 31869 35192178 ~ 35192529 (-)
G346765 NA non-coding upstream 72712 35233021 ~ 35233655 (-)
G346797 NA non-coding upstream 129138 35289447 ~ 35289743 (-)
G346857 NA non-coding upstream 244462 35404771 ~ 35408467 (-)
G346902 NA non-coding upstream 306651 35466960 ~ 35467199 (-)
G345255 LOC106585892 other downstream 1369965 33789494 ~ 33790085 (-)
G345248 NA other downstream 1379412 33780297 ~ 33780638 (-)
G346754 NA other upstream 57015 35217324 ~ 35217782 (-)
G347016 NA other upstream 391764 35552073 ~ 35552585 (-)
G347456 NA other upstream 724238 35884547 ~ 35884910 (-)
G349765 NA other upstream 3055570 38215879 ~ 38216887 (-)
G350352 LOC106608159 other upstream 3724043 38884352 ~ 38885882 (-)

Expression


G346728 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G346728 Expression in each Bioproject

Bar chart with 11 bars.
G346728 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network