G347178



Basic Information


Item Value
gene id G347178
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 35908246 ~ 35908451 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU392802
aggtgaacatggtcatagagacggtccagatcgagggtggggactgtctccctgtacaggtgaacatggtcatagagacggtccagatcgagggtggggactgtctccctgtacaggtgaacatggtcatagagacagtccagatcgagggtggggactgtctccctgtacaggtgaacatggtcatagagacggtccagatcgag

Function


NR:

description
PREDICTED: uncharacterized protein LOC106576300

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU392802 True 206 TUCP 0.55 1 35908246 35908451

Neighbor


gene id symbol gene type direction distance location
LOC118964470 NA coding upstream 24006 35883168 ~ 35884241 (+)
LOC110522558 LOC106571671 coding upstream 88938 35803948 ~ 35819308 (+)
LOC110522555 LOC106608214 coding upstream 146987 35732092 ~ 35761259 (+)
LOC110521090 LOC106608213 coding upstream 184653 35561988 ~ 35723593 (+)
LOC110521089 LOC106608211 coding upstream 489822 35249617 ~ 35418424 (+)
LOC110522562 LOC105017690 coding downstream 130645 36039096 ~ 36123362 (+)
LOC110522563 LOC106608227 coding downstream 230505 36138956 ~ 36158325 (+)
LOC110522575 NA coding downstream 1130104 37038555 ~ 37040052 (+)
snw1 LOC106608236 coding downstream 1244573 37153024 ~ 37167042 (+)
LOC110517371 LOC106571681 coding downstream 1279559 37188010 ~ 37226273 (+)
G347177 NA non-coding upstream 306 35907689 ~ 35907940 (+)
G347173 NA non-coding upstream 6931 35901101 ~ 35901315 (+)
G347155 NA non-coding upstream 65967 35841957 ~ 35842279 (+)
G347153 NA non-coding upstream 68581 35839390 ~ 35839665 (+)
G347210 NA non-coding downstream 72697 35981148 ~ 35981926 (+)
G347233 NA non-coding downstream 216957 36125408 ~ 36128946 (+)
G347236 NA non-coding downstream 221998 36130449 ~ 36130907 (+)
G347604 NA non-coding downstream 225046 36133497 ~ 36133739 (+)
G347619 NA non-coding downstream 251270 36159721 ~ 36160047 (+)
G347151 NA other upstream 74402 35833369 ~ 35833844 (+)
G346334 NA other upstream 833908 35073939 ~ 35074338 (+)
LOC110522546 LOC106608201 other upstream 1086064 34807607 ~ 34831281 (+)
LOC110522530 LOC106608164 other upstream 1368786 34536950 ~ 34541410 (+)
LOC110522536 LOC105024319 other upstream 1515983 34390869 ~ 34394175 (+)
G348133 NA other downstream 1251643 37160094 ~ 37161123 (+)
LOC110522576 LOC106608246 other downstream 1537016 37445368 ~ 37501952 (+)
G349855 NA other downstream 2496194 38404645 ~ 38405464 (+)
G349877 NA other downstream 2523728 38432179 ~ 38434024 (+)

Expression


G347178 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G347178 Expression in each Bioproject

Bar chart with 15 bars.
G347178 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network