G350219


Basic Information

Item Value
gene id G350219
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 38763927 ~ 38764322 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU396298
CTGGGGTGCTGCTTCCATCAAAACTAGCACTCTAACATCTCAGGGTACCTGGGGTGCTGCTTCCATCAAAACTAGCACTCTAACATCTCAGGGTACCTGGGGTGCGTCTTCCATCAGAACTAGCACTCGAACATCTCAGGGTACCTGGGGTGCCACTTTCATCAAAACTAGCACTCGAACATCTCAGGGTACCTGGGGTGCTGCTTCCATCAAAACTAGCACTCTAACATCTCAGGGTACCTGGGGTGCTGCTTCCATCAAAACTAGCACTCGAACATCTCAGGGTACCTGGGGTGCCACTTTCATCAAAACTAGCACTCGAACATCTCAGGGTACCTGGGGTGCTGCTTCCATCAAAACTAGCACTCTAACATCTCAGGGTACCTGGGGTGCTGC

Function

NR:

description
PREDICTED: A disintegrin and metalloproteinase with thrombospondin motifs 8-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU396298 True 396 lncRNA 0.52 1 38763927 38764322

Neighbor

gene id symbol gene type direction distance location
thbs1b LOC106608163 coding upstream 112865 38626216 ~ 38651062 (+)
LOC110522580 LOC106608254 coding upstream 472389 38288197 ~ 38291538 (+)
LOC110521100 LOC106608253 coding upstream 529249 37969722 ~ 38234678 (+)
LOC110522584 LOC106608258 coding upstream 864719 37897636 ~ 37899208 (+)
LOC110521098 LOC106608260 coding upstream 866403 37879402 ~ 37897524 (+)
LOC110522590 NA coding downstream 53578 38817900 ~ 38820524 (+)
LOC118964474 LOC106608159 coding downstream 61461 38825783 ~ 38885772 (+)
LOC110522591 LOC105024333 coding downstream 125992 38890314 ~ 38897681 (+)
LOC118964476 NA coding downstream 135082 38898435 ~ 38900534 (+)
LOC110522592 LOC106608157 coding downstream 157016 38921338 ~ 38942012 (+)
G350213 NA non-coding upstream 121 38760418 ~ 38763806 (+)
G350193 NA non-coding upstream 23029 38740687 ~ 38740898 (+)
G350186 NA non-coding upstream 30757 38732947 ~ 38733170 (+)
G349999 NA non-coding upstream 91281 38672444 ~ 38672646 (+)
G349989 NA non-coding upstream 118468 38643985 ~ 38645459 (+)
G350221 NA non-coding downstream 2842 38767164 ~ 38767380 (+)
G350225 NA non-coding downstream 17552 38781874 ~ 38782902 (+)
G350232 NA non-coding downstream 41398 38805720 ~ 38806230 (+)
G350206 NA non-coding downstream 44608 38808930 ~ 38809369 (+)
G350210 NA non-coding downstream 52025 38816347 ~ 38817388 (+)
G349877 NA other upstream 329903 38432179 ~ 38434024 (+)
G349855 NA other upstream 358463 38404645 ~ 38405464 (+)
LOC110522576 LOC106608246 other upstream 1266921 37445368 ~ 37501952 (+)
G348133 NA other upstream 1602804 37160094 ~ 37161123 (+)
LOC110522562 LOC105017690 other upstream 2690971 36039096 ~ 36123362 (+)
G350211 NA other downstream 139408 38903730 ~ 38904774 (+)
G350665 NA other downstream 623819 39388141 ~ 39389474 (+)
G351441 NA other downstream 1370365 40134687 ~ 40136773 (+)
G352136 LOC106608303 other downstream 2225837 40990159 ~ 40990505 (+)

Expression


Co-expression Network