G351013



Basic Information


Item Value
gene id G351013
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 39612872 ~ 39613618 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU397255
CTCTGACCTCCAGAAGCAGCTCTGTCATAAAGACGCAGAGCGTAGCAGGTCTCCACTATCCTCTACACGTTTTCATCACGAGGCTGAGGTTTAGCAGTGACACGCACACCCTGGAAGTGACAGGACCGTGACAGGATGGTTCTATGTTAGTTCTGTCTCAACCCCTGACCCAGGCTATCCCTCTCCTGCTTAGCTGTGGTCCTCCCACAGTCTTTACTCTCCCTGGTTAGTAGGGAACAGAGGAGGCTTCCCCCCCTACCACACACTACAGGAGTAGGGAACAGACACACTACAGGGGTAGGGAACAGACACACTACAGGGGTAGGGAACAGACACACTACAGGAGTAGGGAACAGACACACTACAGGAGTAGGGAACAGACACACTACAGGAGTAGGGAACAGACACACTACAGGGGTAGGGAACAGACACACTACAGGGGTAGGGAACAGACACACTACAGGGGTAGGGAACAGACACACTACAGGGGTAGGGAACAGAGG

Function


NR:

description
PREDICTED: cytospin-A-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU397255 True 503 lncRNA 0.53 2 39612872 39613618

Neighbor


gene id symbol gene type direction distance location
LOC110522615 LOC106608271 coding downstream 85732 39523336 ~ 39527140 (-)
LOC118964478 NA coding downstream 139719 39462938 ~ 39473153 (-)
LOC110522614 dpf3 coding downstream 170891 39393845 ~ 39441981 (-)
LOC110522594 LOC106571083 coding downstream 704388 38906749 ~ 38908484 (-)
LOC110521103 LOC106608191 coding downstream 706750 38899139 ~ 38906122 (-)
chac1 chac1 coding upstream 39538 39653156 ~ 39655304 (-)
dll4 LOC106608273 coding upstream 64608 39678226 ~ 39706221 (-)
LOC118964500 NA coding upstream 516948 40130566 ~ 40131883 (-)
LOC110522605 LOC106591683 coding upstream 744347 40357965 ~ 40379336 (-)
LOC110522598 LOC106591683 coding upstream 764261 40356410 ~ 40420633 (-)
G351012 NA non-coding downstream 911 39611362 ~ 39611961 (-)
G350902 NA non-coding downstream 76108 39477743 ~ 39536764 (-)
G350939 NA non-coding downstream 163047 39449582 ~ 39449825 (-)
G350936 NA non-coding downstream 167601 39445065 ~ 39445271 (-)
G350906 NA non-coding downstream 223423 39388590 ~ 39389449 (-)
G351005 NA non-coding upstream 37731 39651349 ~ 39651678 (-)
G351031 NA non-coding upstream 46374 39659992 ~ 39660270 (-)
G351044 NA non-coding upstream 75595 39689213 ~ 39689537 (-)
G351055 NA non-coding upstream 106759 39720377 ~ 39720609 (-)
G351057 NA non-coding upstream 112159 39725777 ~ 39726053 (-)
G350563 LOC106608153 other downstream 461635 39150509 ~ 39151237 (-)
G350352 LOC106608159 other downstream 726990 38884352 ~ 38885882 (-)
G349765 NA other downstream 1395985 38215879 ~ 38216887 (-)
G347456 NA other downstream 3727962 35884547 ~ 35884910 (-)
G347016 NA other downstream 4060287 35552073 ~ 35552585 (-)
G351054 NA other upstream 105166 39718784 ~ 39719131 (-)
G351886 NA other upstream 1051474 40665092 ~ 40665478 (-)
G351896 NA other upstream 1063848 40677466 ~ 40678114 (-)
G352537 NA other upstream 1808629 41422247 ~ 41422752 (-)
G352723 NA other upstream 1914350 41527968 ~ 41529100 (-)

Expression


G351013 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G351013 Expression in each Bioproject

Bar chart with 12 bars.
G351013 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network