G352329



Basic Information


Item Value
gene id G352329
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 41192957 ~ 41193335 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU398965
ttgaaaatttcaataagcatttttctacggctggccatgctttccacctggctactcctaccccggtcaacagcactgcaccccccacagcaactcgcccaagccttccccatttctccttctcccaaatccgttcagctgatgttctgaatgagctgcaaaatctggacccctacaaatcagccgggctagacaatctggaccctttctttctaaaattatctgccgaaattgttgccacccctattactagcctgttcaacctctctttcgtgtcgtctgagattcccaaagattggaaagcagctgcggtcatccccctcttcaaagggggggacactcttgacccaaactgctacagacctatatctatcctacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU398965 True 379 lncRNA 0.49 1 41192957 41193335

Neighbor


gene id symbol gene type direction distance location
LOC110521114 LOC106608298 coding upstream 107269 41071482 ~ 41085688 (+)
LOC118964399 LOC106608301 coding upstream 151918 41038237 ~ 41041039 (+)
abcd4 abcd4 coding upstream 247953 40918240 ~ 40945004 (+)
LOC118964481 NA coding upstream 251990 40940631 ~ 40940967 (+)
hmbox1b LOC106608307 coding upstream 305452 40868340 ~ 40887505 (+)
LOC110522636 LOC106608297 coding downstream 233545 41426880 ~ 41445268 (+)
LOC110522641 LOC106608294 coding downstream 455457 41648792 ~ 41651426 (+)
LOC110522642 LOC106608292 coding downstream 471267 41664602 ~ 41675680 (+)
LOC110522643 LOC106608291 coding downstream 482926 41676261 ~ 41681946 (+)
LOC110522644 ptk2b coding downstream 690930 41884265 ~ 41934580 (+)
G352319 NA non-coding upstream 6323 41186424 ~ 41186634 (+)
G352316 NA non-coding upstream 8379 41184343 ~ 41184578 (+)
G352240 NA non-coding upstream 45939 41144830 ~ 41147018 (+)
G352231 NA non-coding upstream 66114 41125004 ~ 41126843 (+)
G352213 NA non-coding upstream 95251 41091055 ~ 41097706 (+)
G352341 NA non-coding downstream 17778 41211113 ~ 41214206 (+)
G352344 NA non-coding downstream 26385 41219720 ~ 41221378 (+)
G352362 NA non-coding downstream 69185 41262520 ~ 41269549 (+)
G352364 NA non-coding downstream 80538 41273873 ~ 41274581 (+)
G352373 LOC106581475 non-coding downstream 96401 41289736 ~ 41290052 (+)
G352136 LOC106608303 other upstream 202452 40990159 ~ 40990505 (+)
G351441 NA other upstream 1056184 40134687 ~ 40136773 (+)
G350665 NA other upstream 1803483 39388141 ~ 39389474 (+)
G350211 NA other upstream 2288183 38903730 ~ 38904774 (+)
LOC110522591 LOC105024333 other upstream 2295301 38890314 ~ 38897681 (+)
G352340 NA other downstream 16912 41210247 ~ 41210998 (+)
G352477 NA other downstream 172866 41366201 ~ 41366607 (+)
G353125 NA other downstream 931341 42124676 ~ 42125759 (+)
LOC118964483 NA other downstream 1126365 42319401 ~ 42328637 (+)

Expression


G352329 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G352329 Expression in each Bioproject

Bar chart with 20 bars.
G352329 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network