G354099



Basic Information


Item Value
gene id G354099
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 42882348 ~ 42882547 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU401186
GTCTTTTCACTATACTGAATGAGTTCTGCAGGAGACAAACATTCTGTCTCTTCACTATACTGAATGAGTTCTGCAGGAGACAACCATTCTGTCTCTTCACTATACTGAATTAGTTCTGCAGGAGACAACCATTCTGTCTCTTCATTATACTGAATGAGTTCTGCAGGAGACAACCATTCGGTCTCTTCATTATACTGAAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU401186 True 200 lncRNA 0.40 1 42882348 42882547

Neighbor


gene id symbol gene type direction distance location
LOC118964503 LOC106608337 coding downstream 23678 42854483 ~ 42858670 (-)
blk LOC106608341 coding downstream 48427 42795327 ~ 42833921 (-)
LOC118964502 NA coding downstream 104567 42773672 ~ 42777781 (-)
fndc4a LOC106608330 coding downstream 126356 42678109 ~ 42755992 (-)
LOC110522652 LOC106608329 coding downstream 426422 42442058 ~ 42455926 (-)
trnal-cag-3 NA coding upstream 9505 42892052 ~ 42892134 (-)
LOC110522657 LOC106608338 coding upstream 30770 42913317 ~ 42916945 (-)
pinx1 pinx1 coding upstream 54785 42937332 ~ 43009175 (-)
LOC118964484 NA coding upstream 138098 43020645 ~ 43022752 (-)
tdh LOC106608345 coding upstream 141156 43023703 ~ 43049588 (-)
G354056 NA non-coding downstream 99075 42782707 ~ 42783273 (-)
G354047 NA non-coding downstream 120337 42761364 ~ 42762011 (-)
G354046 NA non-coding downstream 124082 42758021 ~ 42758266 (-)
G353716 NA non-coding downstream 153163 42728342 ~ 42729185 (-)
G353706 NA non-coding downstream 176198 42704765 ~ 42706150 (-)
G354101 NA non-coding upstream 2323 42884870 ~ 42885331 (-)
G354110 NA non-coding upstream 26851 42909398 ~ 42909705 (-)
G354105 NA non-coding upstream 28311 42910858 ~ 42912129 (-)
G354119 NA non-coding upstream 50336 42932883 ~ 42933216 (-)
G354141 NA non-coding upstream 107705 42990252 ~ 42990959 (-)
nme6 nme6 other downstream 584017 42291051 ~ 42298455 (-)
G353203 NA other downstream 731741 42150122 ~ 42150607 (-)
G352948 NA other downstream 1039863 41842113 ~ 41842485 (-)
G354412 NA other upstream 656182 43538729 ~ 43539326 (-)
G354961 NA other upstream 889647 43772194 ~ 43772679 (-)
G354975 NA other upstream 958360 43840907 ~ 43842118 (-)
G355110 NA other upstream 1307762 44190309 ~ 44191018 (-)

Expression


G354099 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G354099 Expression in each Bioproject

Bar chart with 4 bars.
G354099 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 175.
End of interactive chart.

Co-expression Network