LOC110523244 (LOC106570388)


Basic Information

Item Value
gene id LOC110523244
gene name LOC106570388
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 13973298 ~ 13982903 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XM_021601767.1
GGATTACGAAGATTCTGATTGGTCGATAATAACCCGGTAGATGTTCCTAACTGGCCCCTCAACTTCCTTTTTGGTGAGCCATCAGCGACGACGATGGCTAAAATCAAGGCTCGAGACTTGCGGGGCAAGAAGAAGGAGGAGCTCCTTAAACAGCTTGAAGACCTCAAGGTGGAACTATCTCAGCTCCGTGTTGCCAAGGTTACGGGTGGTGCTGCATCCAAACTGTCCAAGATCCGTGTCGTTCGGAAGTCCATTGCCAGAGTCCTGACAGTTGTCAACCAGACCCAGAAGGAGAACCTGAGGAAATTCTACAAGGGTAAGAAGTACAAGCCCCTGGATCTGAGGCCCAGGAAGACCCGTGCCATTCGCAGGCGGCTGAACAAACATGAGGAGAGTCGGATGACCAAAAAGATGCAGAGGAAATCACGCTTGTACACTATTCGCAAGTTCGCTGTCAAGGCTTGAGTCTGTACCTTTTTTTGTATTGAAAATAAATGACCTTTCCCAGGAAAAAAGATAA

Function

NR:

description
60S ribosomal protein L35

GO:

id name namespace
GO:0051726 regulation of cell cycle biological_process
GO:0006412 translation biological_process
GO:0009790 embryo development biological_process
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02918 RP-L35e, RPL35; large subunit ribosomal protein L35e

RNA

RNA id representative length rna type GC content exon number start site end site
XM_021601767.1 True 520 mRNA 0.48 4 13973298 13982903

Neighbor

gene id symbol gene type direction distance location
si:dkey-220k22.1 LOC106570374 coding downstream 37 13892936 ~ 13973261 (-)
glipr2 LOC106570345 coding downstream 175642 13782097 ~ 13797656 (-)
zgc:55461 tubb4b coding downstream 202702 13766485 ~ 13770596 (-)
pole3 pole3 coding downstream 360465 13608582 ~ 13612833 (-)
lrsam1 lrsam1 coding downstream 372278 13580344 ~ 13601020 (-)
scai LOC106570398 coding upstream 8394 13991297 ~ 14030388 (-)
LOC118964563 NA coding upstream 21402 14004305 ~ 14005852 (-)
LOC110523246 ppp6c coding upstream 56475 14039378 ~ 14052301 (-)
si:dkey-220k22.3 LOC106570668 coding upstream 74662 14057565 ~ 14060716 (-)
p2rx4a p2rx4 coding upstream 80117 14063020 ~ 14080614 (-)
G370141 NA non-coding downstream 86792 13885217 ~ 13886506 (-)
G370072 NA non-coding downstream 237695 13735211 ~ 13735603 (-)
G370057 NA non-coding downstream 258029 13715026 ~ 13715269 (-)
G370056 NA non-coding downstream 260193 13712863 ~ 13713105 (-)
G370042 NA non-coding downstream 273869 13699178 ~ 13699429 (-)
G370250 NA non-coding upstream 53320 14036223 ~ 14036462 (-)
G370251 NA non-coding upstream 53622 14036525 ~ 14036808 (-)
G370278 NA non-coding upstream 107090 14089993 ~ 14090353 (-)
LOC118964564 gstt2b non-coding upstream 107880 14090638 ~ 14092907 (-)
G368921 NA other downstream 1267206 12705566 ~ 12706092 (-)
G368612 ctxn3 other downstream 1836508 12134052 ~ 12136790 (-)
G365752 NA other downstream 4783200 9189669 ~ 9190098 (-)
G364754 NA other downstream 4922590 9047542 ~ 9099000 (-)
G364322 NA other downstream 5669115 8303267 ~ 8304183 (-)
G370333 NA other upstream 224287 14207190 ~ 14208705 (-)
G370635 NA other upstream 444435 14427338 ~ 14428591 (-)
LOC110524957 LOC106569957 other upstream 1010225 14988147 ~ 14995197 (-)
G371294 LOC106569911 other upstream 1140572 15123475 ~ 15124789 (-)
LOC110523302 NA other upstream 1713189 15693396 ~ 15707607 (-)

Expression


Co-expression Network