LOC118964770



Basic Information


Item Value
gene id LOC118964770
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 69085182 ~ 69085265 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005051963.1
CTGATTCAATGATGACTGCATAGTTAAGCAGCTAAACCATGATGAATATTTAGCGTTGTCTTTCACTCCTATCTGATGTGTAGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005051963.1 True 84 mRNA 0.38 1 69085182 69085265
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110524435 LOC106613903 coding downstream 8973 69066016 ~ 69076209 (-)
LOC110522990 LOC106613902 coding downstream 30966 69050540 ~ 69054216 (-)
eps15 NA coding downstream 34804 69025921 ~ 69050378 (-)
ttc39a LOC106613900 coding downstream 61238 68979017 ~ 69023944 (-)
rnf11b LOC106613899 coding downstream 106733 68944931 ~ 68978449 (-)
LOC110524436 LOC106613904 coding upstream 1694 69086959 ~ 69135091 (-)
LOC110524437 abl2 coding upstream 58209 69143474 ~ 69187261 (-)
soat1 soat1 coding upstream 102597 69187862 ~ 69198259 (-)
si:dkey-21p1.3 LOC106613908 coding upstream 113222 69198487 ~ 69228669 (-)
LOC110524442 LOC106613910 coding upstream 154266 69239531 ~ 69350551 (-)
G432389 NA non-coding downstream 257532 68826974 ~ 68827650 (-)
G432377 NA non-coding downstream 278862 68806014 ~ 68806320 (-)
G432338 NA non-coding downstream 336199 68748558 ~ 68755057 (-)
G432084 NA non-coding downstream 701420 68345154 ~ 68383762 (-)
G432448 NA non-coding upstream 62365 69147630 ~ 69149826 (-)
G433669 NA non-coding upstream 383778 69469043 ~ 69469372 (-)
G433670 cep350 non-coding upstream 384499 69469764 ~ 69470321 (-)
G433680 NA non-coding upstream 399072 69484337 ~ 69484789 (-)
G432513 NA other downstream 79076 69004619 ~ 69006106 (-)
G432310 LOC106613894 other downstream 377734 68699821 ~ 68707448 (-)
bend5 LOC106584333 other downstream 732437 68331871 ~ 68352828 (-)
lrrc7 LOC106613881 other downstream 1267058 67810595 ~ 67983549 (-)
G433683 LOC106613912 other upstream 437549 69486406 ~ 69524790 (-)
G435234 NA other upstream 1905627 70990892 ~ 70991798 (-)
G435176 NA other upstream 1982760 71068025 ~ 71068887 (-)
LOC110524478 LOC106613944 other upstream 2143917 71226012 ~ 71242283 (-)
il23r LOC106613945 other upstream 2201125 71285725 ~ 71308015 (-)

Expression


LOC118964770 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

LOC118964770 Expression in each Bioproject

Bar chart with 5 bars.
LOC118964770 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network