G357847



Basic Information


Item Value
gene id G357847
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 844918 ~ 845402 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU406302
GGTGTGACCTTGACCTCTAGAACCTGAAGGCTGCTGTTAACACCAGTGGTGTGACCTTGACCTCTAGAACCTGAAGGCTGCTGTTAACACCAGGGGTGTTAGTACCAGTGGTGTTAGTACCAGTGGTGTGACCCTGACCTCTAGAACCTGAAGGCTGCTGTTAACACCAGTGGTGTTAGTACCAGTGGTGTGACCCTGACCTCTAGGGTAACTTAGTCAATGGAAGCTCTCTAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU406302 True 235 lncRNA 0.51 2 844918 845402

Neighbor


gene id symbol gene type direction distance location
fktn fktn coding downstream 34805 787758 ~ 810394 (-)
ythdc1 ythdc1 coding downstream 85536 724581 ~ 759382 (-)
LOC110523080 LOC106572757 coding downstream 128499 703311 ~ 716419 (-)
LOC110523078 LOC106572764 coding downstream 162367 636428 ~ 682551 (-)
LOC118964546 NA coding downstream 239809 603412 ~ 605109 (-)
LOC110523076 LOC106572700 coding upstream 66033 911435 ~ 917121 (-)
LOC110523100 NA coding upstream 90943 936345 ~ 939419 (-)
LOC110523113 mob3b coding upstream 94797 940199 ~ 1004906 (-)
LOC110523114 thap1 coding upstream 167343 1012745 ~ 1015374 (-)
LOC110523115 LOC106572830 coding upstream 191457 1036859 ~ 1051078 (-)
G357800 NA non-coding downstream 24256 819463 ~ 820662 (-)
G357797 NA non-coding downstream 26219 817154 ~ 818747 (-)
G357804 NA non-coding downstream 65981 774948 ~ 778937 (-)
G357810 NA non-coding downstream 112429 730895 ~ 732489 (-)
G357850 NA non-coding upstream 9639 855041 ~ 855459 (-)
G357851 NA non-coding upstream 13543 858945 ~ 861868 (-)
G357871 NA non-coding upstream 68510 913912 ~ 914259 (-)
G357886 NA non-coding upstream 129039 974441 ~ 975951 (-)
G357751 NA other downstream 153220 690811 ~ 691698 (-)
G357278 NA other downstream 599894 244749 ~ 245024 (-)
G357258 NA other downstream 635577 207105 ~ 209341 (-)
G358126 NA other upstream 450126 1295528 ~ 1298651 (-)
G358446 NA other upstream 999422 1834553 ~ 1893316 (-)
G359712 NA other upstream 2229143 3074545 ~ 3080338 (-)
G359752 NA other upstream 2347111 3192513 ~ 3193105 (-)
G359989 NA other upstream 2779946 3625348 ~ 3625776 (-)

Expression


G357847 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G357847 Expression in each Bioproject

Bar chart with 13 bars.
G357847 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network