G359908



Basic Information


Item Value
gene id G359908
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 3569316 ~ 3570365 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU408839
ggagaggcatgcttagtcgagtgatcaaaagggtccagtgagtggagaggttggtttagggtcacggcgatttagacagctagccaagccaaccggtagcaagctagcataggatggagtctgttgttagccacctcttgcgttcggtcagtagattagtggggttccgtgtggtagaggggattaatccaaatcacacaacaacaacaaaaataagaacaatagatatagttatagaggcccgagaagaaaacataataataaaaatatggggctccgcgtaggcagtgaaacgggtccggataggtgactgcagcacaggagtgaatgatggaactcaggagtgattgacggagctggctagcaccggaacaatcgatgtttgctccggaatcgacgaaagccgactgtcacacggatagcagctagctagctgtgagatccgggtatgaatgtccagagagcagttgaaatccagggacatggagagaaaaattggtccggtatgttccgttccgagccgcgctgcgccgtacaaaactggcgatagattttcgatagattttcgagctaaaggacagccgatgaccacaaaccgtggttagcttctgattagcttctggattagcttctgggctagctcctggctagcttctggctagtttctggccagcctcctggagtttctggctagcttcctgaaggattgcagatctgaggtaaataatacttttttataaatataaattggtgaggctggttgcaggagagtgtttagaagatgagttgatggaaaaaaaataaaatgtatgtgaaaaaagttgtaaatatatatatatacaggacacgacaagacgaggacaaaagacgtctgaactgctatgcgatcttggaaga

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU408839 True 897 lncRNA 0.46 2 3569316 3570365

Neighbor


gene id symbol gene type direction distance location
LOC118964540 NA coding downstream 71082 3497350 ~ 3498234 (-)
lpar1 LOC106572527 coding downstream 115536 3392167 ~ 3453780 (-)
rassf6 LOC106572546 coding downstream 384107 3154684 ~ 3185209 (-)
LOC118964539 NA coding downstream 1508458 2009134 ~ 2060858 (-)
LOC110523086 LOC106572646 coding downstream 1658969 1908949 ~ 1910347 (-)
LOC110523109 lppr1 coding upstream 73805 3644170 ~ 3669873 (-)
LOC118964541 NA coding upstream 92134 3662499 ~ 3669678 (-)
LOC110513199 dcc coding upstream 214177 3782114 ~ 4417531 (-)
fech fech coding upstream 1044636 4615001 ~ 4638131 (-)
nars1 sync coding upstream 1068655 4639020 ~ 4647952 (-)
G359902 NA non-coding downstream 5134 3563802 ~ 3564182 (-)
G359854 NA non-coding downstream 51051 3454439 ~ 3518265 (-)
G359879 NA non-coding downstream 51846 3513620 ~ 3517470 (-)
G359818 NA non-coding downstream 238055 3330604 ~ 3331261 (-)
G359775 NA non-coding downstream 309486 3258926 ~ 3259830 (-)
G359929 NA non-coding upstream 20570 3590935 ~ 3591212 (-)
G359996 NA non-coding upstream 70055 3640420 ~ 3640631 (-)
G360011 NA non-coding upstream 122602 3692967 ~ 3713162 (-)
G360012 NA non-coding upstream 127424 3697789 ~ 3698970 (-)
G360013 NA non-coding upstream 128609 3698974 ~ 3702033 (-)
G359752 NA other downstream 376211 3192513 ~ 3193105 (-)
G359712 NA other downstream 488978 3074545 ~ 3080338 (-)
G358446 NA other downstream 1676000 1834553 ~ 1893316 (-)
G358126 NA other downstream 2270665 1295528 ~ 1298651 (-)
G357797 NA other downstream 2750569 817154 ~ 818747 (-)
G359989 NA other upstream 54983 3625348 ~ 3625776 (-)
G360015 NA other upstream 143867 3714232 ~ 3715552 (-)
G360345 NA other upstream 177871 3748236 ~ 3748718 (-)
G360532 NA other upstream 729027 4299392 ~ 4300025 (-)

Expression


G359908 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G359908 Expression in each Bioproject

Bar chart with 20 bars.
G359908 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network