G362707



Basic Information


Item Value
gene id G362707
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 8090256 ~ 8090493 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU412323
TGGCTACTCAGGTTGCTCAGGCTACTCAGGTTTCTCTGGCTACTATGGCTACTCAGGTTTCTCTGGCTACTCAGGTTTCTCTGGCTACTCAGGTTGCTCTGGCTACTCAGGTTGCTCTGGCTACTCAGGTTTCTCTGGCTACTCAGGTTGCTCTGGCTACTCAGGTTGCTCTGGCTACTCTGGCTTGCCAGGCATTTCTGATTTCCTCCGACCTCCCATTACACCCCTTGTGTGTTTT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU412323 True 238 lncRNA 0.52 1 8090256 8090493
Loading

Neighbor


gene id symbol gene type direction distance location
mapkap1 mapkap1 coding upstream 221691 7742247 ~ 7868565 (+)
LOC118964556 NA coding upstream 348331 7730984 ~ 7741925 (+)
LOC118964554 angptl2 coding upstream 1058274 7002452 ~ 7031982 (+)
LOC110523126 LOC106572095 coding upstream 1534762 6488402 ~ 6555494 (+)
LOC110522836 LOC105008486 coding upstream 2329308 5672649 ~ 5760948 (+)
slc27a6 slc27a6 coding downstream 159666 8250159 ~ 8289257 (+)
isoc1 isoc1 coding downstream 200362 8290855 ~ 8307147 (+)
LOC110524944 adamts19 coding downstream 293152 8383645 ~ 8507630 (+)
minar2 kiaa1024l coding downstream 420140 8510633 ~ 8515635 (+)
chsy3 chsy3 coding downstream 426763 8517256 ~ 8701336 (+)
G362706 NA non-coding upstream 3112 8086931 ~ 8087144 (+)
G362704 NA non-coding upstream 9878 8080167 ~ 8080378 (+)
G362698 NA non-coding upstream 18303 8071606 ~ 8071953 (+)
G362697 NA non-coding upstream 19146 8070904 ~ 8071110 (+)
G362685 NA non-coding upstream 48020 8041960 ~ 8042236 (+)
G362708 NA non-coding downstream 4241 8094734 ~ 8094957 (+)
G362722 NA non-coding downstream 35247 8125740 ~ 8126016 (+)
G362726 NA non-coding downstream 39141 8129634 ~ 8129837 (+)
G362733 NA non-coding downstream 50132 8140625 ~ 8140938 (+)
G362735 NA non-coding downstream 51657 8142150 ~ 8142389 (+)
G362662 NA other upstream 170691 7918922 ~ 7919565 (+)
G362554 NA other upstream 397742 7690440 ~ 7692514 (+)
G362297 zbtb43 other upstream 900437 7185926 ~ 7189819 (+)
G361671 NA other upstream 2162330 5803828 ~ 5927926 (+)
G360985 NA other upstream 2790853 5296870 ~ 5299403 (+)
cdc42se2 cdc42se2 other downstream 684839 8775134 ~ 8849107 (+)
G364850 NA other downstream 1138345 9228838 ~ 9229231 (+)
G365197 NA other downstream 1758210 9848703 ~ 9849154 (+)
G366748 NA other downstream 2886189 10976682 ~ 10977152 (+)
G366973 NA other downstream 3335149 11425642 ~ 11428710 (+)

Expression


G362707 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G362707 Expression in each Bioproject

Bar chart with 7 bars.
G362707 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network