G362736



Basic Information


Item Value
gene id G362736
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 8142441 ~ 8142818 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU412353
acagtgagggaaaaacgtatttgatcccctgctgattttgtacgtttgcccactgacaaagaaattatccgtctataattttaatggtaggtttatttgaacagtgagagacaggataacaacaaaaaaatccagaaaaacgcatgtcaaaaatgttataaattgatttgcatttcaatgagggaaataagtatttgaccccctctcaatcagaaagatttctggctcccaggtgttttttatacaggtaacgagctgaaattaggagcacactcttaatgggagcttgttacctgtataaaagaaacctgtccacagaagctatcagtcaatcagattccaaatgctccaccatggccaagaccaaagagttctcca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU412353 True 378 lncRNA 0.38 1 8142441 8142818

Neighbor


gene id symbol gene type direction distance location
mapkap1 mapkap1 coding upstream 273876 7742247 ~ 7868565 (+)
LOC118964556 NA coding upstream 400516 7730984 ~ 7741925 (+)
LOC118964554 angptl2 coding upstream 1110459 7002452 ~ 7031982 (+)
LOC110523126 LOC106572095 coding upstream 1586947 6488402 ~ 6555494 (+)
LOC110522836 LOC105008486 coding upstream 2381493 5672649 ~ 5760948 (+)
slc27a6 slc27a6 coding downstream 107341 8250159 ~ 8289257 (+)
isoc1 isoc1 coding downstream 148037 8290855 ~ 8307147 (+)
LOC110524944 adamts19 coding downstream 240827 8383645 ~ 8507630 (+)
minar2 kiaa1024l coding downstream 367815 8510633 ~ 8515635 (+)
chsy3 chsy3 coding downstream 374438 8517256 ~ 8701336 (+)
G362735 NA non-coding upstream 52 8142150 ~ 8142389 (+)
G362733 NA non-coding upstream 1503 8140625 ~ 8140938 (+)
G362726 NA non-coding upstream 12604 8129634 ~ 8129837 (+)
G362722 NA non-coding upstream 16425 8125740 ~ 8126016 (+)
G362708 NA non-coding upstream 47484 8094734 ~ 8094957 (+)
G362737 LOC100846954 non-coding downstream 261 8143079 ~ 8143371 (+)
G362745 NA non-coding downstream 27254 8170072 ~ 8170297 (+)
G362747 NA non-coding downstream 29474 8172292 ~ 8172550 (+)
G362748 NA non-coding downstream 30119 8172937 ~ 8173634 (+)
G362750 NA non-coding downstream 39868 8182686 ~ 8182947 (+)
G362662 NA other upstream 222876 7918922 ~ 7919565 (+)
G362554 NA other upstream 449927 7690440 ~ 7692514 (+)
G362297 zbtb43 other upstream 952622 7185926 ~ 7189819 (+)
G361671 NA other upstream 2214515 5803828 ~ 5927926 (+)
G360985 NA other upstream 2843038 5296870 ~ 5299403 (+)
cdc42se2 cdc42se2 other downstream 632514 8775134 ~ 8849107 (+)
G364850 NA other downstream 1086020 9228838 ~ 9229231 (+)
G365197 NA other downstream 1705885 9848703 ~ 9849154 (+)
G366748 NA other downstream 2833864 10976682 ~ 10977152 (+)
G366973 NA other downstream 3282824 11425642 ~ 11428710 (+)

Expression


G362736 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G362736 Expression in each Bioproject

Bar chart with 20 bars.
G362736 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network