G364259



Basic Information


Item Value
gene id G364259
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 8195821 ~ 8196306 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU414092
ATCCAGGATATATAGTTCAGATCCAGGATATATAGTTCAGATCCAGGTCCAGGATATATAATCCAGGTCCAGGATATATAGTTCAGATCCAGGATATATAGTTCAGATCCAGGATATATAGTTCAGATCAGATCCAGGATATATAGTTCAGATCCAGGATATATAGTTCAGATCCAGGATATATAGTTCAGATCCAGGATATATAGTTCAGATCCAGGATATATTGTTCAGATC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU414092 True 234 lncRNA 0.36 2 8195821 8196306

Neighbor


gene id symbol gene type direction distance location
LOC110523137 pbx3 coding downstream 473694 7593362 ~ 7722127 (-)
mvb12ba mvb12b coding downstream 758902 7394813 ~ 7436919 (-)
LOC110523135 lmx1b coding downstream 828024 7272318 ~ 7367797 (-)
LOC110523134 zbtb43 coding downstream 1001387 7187898 ~ 7194434 (-)
LOC118964555 NA coding downstream 1319897 6875316 ~ 6875924 (-)
LOC110523142 LOC106571805 coding upstream 10185 8206491 ~ 8229291 (-)
hint1 hint1 coding upstream 564525 8760831 ~ 8765948 (-)
LOC110524946 LOC106571878 coding upstream 661311 8857617 ~ 8864575 (-)
syk syk coding upstream 948831 9145137 ~ 9199533 (-)
LOC110523157 lyz2 coding upstream 1107338 9303644 ~ 9306869 (-)
G364257 NA non-coding downstream 687 8188808 ~ 8195134 (-)
G364255 NA non-coding downstream 16331 8179261 ~ 8179490 (-)
G364251 NA non-coding downstream 25462 8170041 ~ 8170359 (-)
G364250 NA non-coding downstream 25890 8169719 ~ 8169931 (-)
G364249 NA non-coding downstream 26599 8169014 ~ 8169222 (-)
G364312 NA non-coding upstream 89709 8286015 ~ 8289236 (-)
G364318 NA non-coding upstream 108945 8305251 ~ 8307147 (-)
G364316 NA non-coding upstream 110200 8306506 ~ 8306983 (-)
G364323 NA non-coding upstream 113332 8309638 ~ 8310134 (-)
G364324 NA non-coding upstream 114016 8310322 ~ 8310541 (-)
LOC110524941 LOC106572051 other downstream 1469841 6562531 ~ 6726634 (-)
G363470 LOC106572095 other downstream 1641106 6543675 ~ 6554715 (-)
LOC110523123 LOC106572171 other downstream 2241570 5945164 ~ 5954687 (-)
G361170 NA other downstream 3113953 5080578 ~ 5081868 (-)
G360703 NA other downstream 3456119 4738312 ~ 4739702 (-)
G364322 NA other upstream 106961 8303267 ~ 8304183 (-)
G364754 NA other upstream 851236 9047542 ~ 9099000 (-)
G365752 NA other upstream 993363 9189669 ~ 9190098 (-)
G368612 ctxn3 other upstream 3937746 12134052 ~ 12136790 (-)
G368921 NA other upstream 4509260 12705566 ~ 12706092 (-)

Expression


G364259 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G364259 Expression in each Bioproject

Bar chart with 13 bars.
G364259 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network