G364322



Basic Information


Item Value
gene id G364322
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 8303267 ~ 8304183 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU414159
gagagagagacgcagagagagagagagagagagagacgcagagagagagagagagagacacgcagagagaggcgcagagagagagatgggtaaaccacttctccaatctttttggctctattacaaagaataaagagcaaaaacatatacatgatcaaatacagatcttagaatcaactattaaagactaccagaacccactggattctccaattacattgaatgagttacaggacaaaataaaaactctccaacccaaaaaggcctgtggtgttgatggtatcctcaatgaaatgatcaaatatacagacaacaaattccaattggctatactaaaactctttaacatcatacttagctctggcatcttccccaatatttggaaccaaggactgatcaccccaatccacaaaagtggagacaaatttgaccccaataactaccgtggaatatgtgtcaacagtaaccttgggaaaatcctctgcattattattaacagcagactcgtacatttcctcaatgaaaacaatgtactgagcaaatgtcaaattggctttttaccaaattaccgtacaacagaccatgtattcaccctgcacaccctaattgacaaccaaacaaaccaaaacaaaggcaaagtcttctcatgctttgttgatttcaaaaaagccttcgactcaatctggcatgagggtctgctatacaaattgatggaaagtggtgttgggggtaaaacatacgacattataaaatccatgtacacaaacaacaagtgtgcggttaaaattggcaaaaaacacacacatttcttcacacagggtcgtggggttagacagggatgcagcttaagccccaccctcttcaacatatatatc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU414159 True 875 TUCP 0.40 2 8303267 8304183
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523142 LOC106571805 coding downstream 73976 8206491 ~ 8229291 (-)
LOC110524943 fbn2 coding downstream 98749 7882389 ~ 8204518 (-)
LOC110523137 pbx3 coding downstream 581140 7593362 ~ 7722127 (-)
mvb12ba mvb12b coding downstream 866348 7394813 ~ 7436919 (-)
LOC110523135 lmx1b coding downstream 935470 7272318 ~ 7367797 (-)
hint1 hint1 coding upstream 456648 8760831 ~ 8765948 (-)
LOC110524946 LOC106571878 coding upstream 553434 8857617 ~ 8864575 (-)
syk syk coding upstream 840954 9145137 ~ 9199533 (-)
LOC110523157 lyz2 coding upstream 999461 9303644 ~ 9306869 (-)
LOC118964557 lyz2 coding upstream 1014342 9318525 ~ 9321762 (-)
G364312 NA non-coding downstream 14031 8286015 ~ 8289236 (-)
G364259 NA non-coding downstream 106961 8195821 ~ 8196306 (-)
G364257 NA non-coding downstream 108133 8188808 ~ 8195134 (-)
G364255 NA non-coding downstream 123777 8179261 ~ 8179490 (-)
G364251 NA non-coding downstream 132908 8170041 ~ 8170359 (-)
G364318 NA non-coding upstream 1068 8305251 ~ 8307147 (-)
G364316 NA non-coding upstream 2323 8306506 ~ 8306983 (-)
G364323 NA non-coding upstream 5455 8309638 ~ 8310134 (-)
G364324 NA non-coding upstream 6139 8310322 ~ 8310541 (-)
G364325 NA non-coding upstream 7095 8311278 ~ 8311522 (-)
LOC110524941 LOC106572051 other downstream 1577287 6562531 ~ 6726634 (-)
G363470 LOC106572095 other downstream 1748552 6543675 ~ 6554715 (-)
LOC110523123 LOC106572171 other downstream 2349016 5945164 ~ 5954687 (-)
G361170 NA other downstream 3221399 5080578 ~ 5081868 (-)
G360703 NA other downstream 3563565 4738312 ~ 4739702 (-)
G364754 NA other upstream 743359 9047542 ~ 9099000 (-)
G365752 NA other upstream 885486 9189669 ~ 9190098 (-)
G368612 ctxn3 other upstream 3829869 12134052 ~ 12136790 (-)
G368921 NA other upstream 4401383 12705566 ~ 12706092 (-)
G370333 NA other upstream 5903007 14207190 ~ 14208705 (-)

Expression


G364322 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G364322 Expression in each Bioproject

Bar chart with 20 bars.
G364322 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network