G364552



Basic Information


Item Value
gene id G364552
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 8707712 ~ 8714451 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU414433
aactaacccatTATACAGAATAACTAACCCATTATACAGActaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctttatacagaaTAACTAACCCATTATACAgaccaactaaccctttatacagaaTAACTAACCCATTATACAgaccaactaaccctttatacaggccaactaaccctttatacagaccaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctttatacaggccaacta
>TU414436
ccctttatacaggccaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctaaccctttatacaggccaactaacactttatacaggccaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctaaccctttatacaggccaactaaccctttatacaggccaactaaccctttatacaggccaactaaccctttatacagaccaactaaccctttatacaggccaactaaccctaaccctttatacaggccaactaacactttatacaggccaactaaccctttatacaggccaactaaccct

Function


NR:

description
PREDICTED: zinc finger protein 585A-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU414433 False 320 lncRNA 0.38 2 8707712 8711968
TU414436 True 379 lncRNA 0.43 2 8713518 8714451
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523142 LOC106571805 coding downstream 478421 8206491 ~ 8229291 (-)
LOC110524943 fbn2 coding downstream 503194 7882389 ~ 8204518 (-)
LOC110523137 pbx3 coding downstream 985585 7593362 ~ 7722127 (-)
mvb12ba mvb12b coding downstream 1270793 7394813 ~ 7436919 (-)
LOC110523135 lmx1b coding downstream 1339915 7272318 ~ 7367797 (-)
hint1 hint1 coding upstream 46380 8760831 ~ 8765948 (-)
LOC110524946 LOC106571878 coding upstream 143166 8857617 ~ 8864575 (-)
syk syk coding upstream 430686 9145137 ~ 9199533 (-)
LOC110523157 lyz2 coding upstream 589193 9303644 ~ 9306869 (-)
LOC118964557 lyz2 coding upstream 604074 9318525 ~ 9321762 (-)
G364534 NA non-coding downstream 29583 8677793 ~ 8678129 (-)
G364532 NA non-coding downstream 34547 8672921 ~ 8673165 (-)
G364531 NA non-coding downstream 35275 8672237 ~ 8672437 (-)
G364528 NA non-coding downstream 37579 8663997 ~ 8670133 (-)
G364519 NA non-coding downstream 61212 8646161 ~ 8646500 (-)
G364555 NA non-coding upstream 6083 8720534 ~ 8720916 (-)
G364559 NA non-coding upstream 11341 8725792 ~ 8726490 (-)
G364572 LOC106569275 non-coding upstream 31146 8745597 ~ 8745819 (-)
G364643 NA non-coding upstream 131277 8845728 ~ 8900234 (-)
G364645 sptlc1 non-coding upstream 166607 8881058 ~ 8886121 (-)
G364322 NA other downstream 403529 8303267 ~ 8304183 (-)
LOC110524941 LOC106572051 other downstream 1981732 6562531 ~ 6726634 (-)
G363470 LOC106572095 other downstream 2152997 6543675 ~ 6554715 (-)
LOC110523123 LOC106572171 other downstream 2753461 5945164 ~ 5954687 (-)
G361170 NA other downstream 3625844 5080578 ~ 5081868 (-)
G364754 NA other upstream 333091 9047542 ~ 9099000 (-)
G365752 NA other upstream 475218 9189669 ~ 9190098 (-)
G368612 ctxn3 other upstream 3419601 12134052 ~ 12136790 (-)
G368921 NA other upstream 3991115 12705566 ~ 12706092 (-)
G370333 NA other upstream 5492739 14207190 ~ 14208705 (-)

Expression


G364552 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G364552 Expression in each Bioproject

Bar chart with 7 bars.
G364552 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 350.
End of interactive chart.

Co-expression Network