G368541



Basic Information


Item Value
gene id G368541
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 11994105 ~ 11995184 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU418877
GTATCCAACAAAGTATCCAACTAGGTATCCAACTAGGTATCCAACTAAGTATCCAACAAAGTATCCAACTAGGTATCCAACTAGGTATCCAACTAAGTATCCAACTAAGTATCCAACTATCTATCCAACTAGGTATCCAACTAGGTATCCAACAAAGTATCCAACTAGGTATCCAACTATCTATCCAACTAGGTATCCAATTATTTATCCAACTAGGTATCCAACTAGGTATCCAACTAGGTATCCAACTAT

Function


NR:

description
hypothetical protein EH28_20584

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU418877 True 252 lncRNA 0.37 2 11994105 11995184
Loading

Neighbor


gene id symbol gene type direction distance location
c5h5orf63 cssa01h5orf63 coding downstream 109530 11880306 ~ 11884575 (-)
marchf3 march3 coding downstream 116104 11856300 ~ 11878001 (-)
LOC110523198 LOC106571668 coding downstream 183088 11808333 ~ 11811017 (-)
aldh7a1 aldh7a1 coding downstream 199705 11787253 ~ 11794400 (-)
LOC110523196 LOC106571245 coding downstream 206863 11748457 ~ 11787242 (-)
LOC110523205 LOC106603399 coding upstream 121736 12116920 ~ 12119545 (-)
LOC110523212 LOC106571134 coding upstream 270809 12265993 ~ 12281595 (-)
LOC110523211 LOC106571125 coding upstream 288971 12284155 ~ 12289326 (-)
LOC110523214 NA coding upstream 299705 12294889 ~ 12297815 (-)
LOC110523209 LOC106571116 coding upstream 307644 12302828 ~ 12313482 (-)
G367755 NA non-coding downstream 163543 11830363 ~ 11830562 (-)
G367728 NA non-coding downstream 224359 11769542 ~ 11769746 (-)
G367725 NA non-coding downstream 231521 11762370 ~ 11762584 (-)
G367723 NA non-coding downstream 233451 11760451 ~ 11760654 (-)
G368577 NA non-coding upstream 61851 12057035 ~ 12057985 (-)
G368587 NA non-coding upstream 71145 12066329 ~ 12149393 (-)
G368557 NA non-coding upstream 96163 12091347 ~ 12093391 (-)
G368606 NA non-coding upstream 130029 12125213 ~ 12126922 (-)
G368634 NA non-coding upstream 167371 12162555 ~ 12162829 (-)
G365752 NA other downstream 2804007 9189669 ~ 9190098 (-)
G364754 NA other downstream 2943397 9047542 ~ 9099000 (-)
G364322 NA other downstream 3689922 8303267 ~ 8304183 (-)
LOC110524941 LOC106572051 other downstream 5268125 6562531 ~ 6726634 (-)
G363470 LOC106572095 other downstream 5439390 6543675 ~ 6554715 (-)
G368612 ctxn3 other upstream 138868 12134052 ~ 12136790 (-)
G368921 NA other upstream 710382 12705566 ~ 12706092 (-)
G370333 NA other upstream 2212006 14207190 ~ 14208705 (-)
G370635 NA other upstream 2432154 14427338 ~ 14428591 (-)
LOC110524957 LOC106569957 other upstream 2997944 14988147 ~ 14995197 (-)

Expression


G368541 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G368541 Expression in each Bioproject

Bar chart with 8 bars.
G368541 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network