G368587



Basic Information


Item Value
gene id G368587
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 12066329 ~ 12149393 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU418924
tgaagatatccctctagtggtgtgggggctgtgctttggcaaagtgggtggggttatatccttcctgtttggccctgtccgggggtgtcctcggagtgggccacagtgtctcctgacccctcctgtctcagcctccagtatttatgctgcagtagtttatgtgtcggggggctagggtcagtttgttatatctggagtacttctcctgtcctattcggtgtcctgtgtgaatctaagtgtgcgttctctaattctctccttctctctttcggaggacctgagccctaggaccatgccccaggactacctgacatgatgactccttgctgtccccagtccacctggctgtgctgctgctccagtttcaactgttctgccttattattattcgaccatgctgatcatttatgaacatttgaacatcttggccatgttctgttataatctccacccggcacagccagaagaggactggccatcccacatatgctctctctaattctctctttctttctctctctcggaggacctgagccctaggaccatgccccaggaatacctgacatgatgactccttgttgtccccagtccacctgactgtgctgctgctccagtttcaactattctgccttattattattcgaccatgctggtcatttatgaacatttgaacatcttgaccatgttttgttataatctccacccggcacagccagaagaggactggccaccccacatagcctggttcctc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU418924 True 751 lncRNA 0.50 2 12066329 12149393
Loading

Neighbor


gene id symbol gene type direction distance location
c5h5orf63 cssa01h5orf63 coding downstream 181754 11880306 ~ 11884575 (-)
marchf3 march3 coding downstream 188328 11856300 ~ 11878001 (-)
LOC110523198 LOC106571668 coding downstream 255312 11808333 ~ 11811017 (-)
aldh7a1 aldh7a1 coding downstream 271929 11787253 ~ 11794400 (-)
LOC110523196 LOC106571245 coding downstream 279087 11748457 ~ 11787242 (-)
LOC110523212 LOC106571134 coding upstream 116600 12265993 ~ 12281595 (-)
LOC110523211 LOC106571125 coding upstream 134762 12284155 ~ 12289326 (-)
LOC110523214 NA coding upstream 145496 12294889 ~ 12297815 (-)
LOC110523209 LOC106571116 coding upstream 153435 12302828 ~ 12313482 (-)
LOC110523210 LOC106571086 coding upstream 175215 12324608 ~ 12340647 (-)
G368577 NA non-coding downstream 8344 12057035 ~ 12057985 (-)
G368541 NA non-coding downstream 71145 11994105 ~ 11995184 (-)
G367755 NA non-coding downstream 235767 11830363 ~ 11830562 (-)
G367728 NA non-coding downstream 296583 11769542 ~ 11769746 (-)
G368634 NA non-coding upstream 13162 12162555 ~ 12162829 (-)
G368635 NA non-coding upstream 13879 12163272 ~ 12163520 (-)
G368647 NA non-coding upstream 26052 12175445 ~ 12175806 (-)
G368584 nkcc1a non-coding upstream 31432 12180825 ~ 12181856 (-)
G368656 NA non-coding upstream 38766 12188159 ~ 12188502 (-)
G365752 NA other downstream 2876231 9189669 ~ 9190098 (-)
G364754 NA other downstream 3015621 9047542 ~ 9099000 (-)
G364322 NA other downstream 3762146 8303267 ~ 8304183 (-)
LOC110524941 LOC106572051 other downstream 5340349 6562531 ~ 6726634 (-)
G363470 LOC106572095 other downstream 5511614 6543675 ~ 6554715 (-)
G368921 NA other upstream 556173 12705566 ~ 12706092 (-)
G370333 NA other upstream 2057797 14207190 ~ 14208705 (-)
G370635 NA other upstream 2277945 14427338 ~ 14428591 (-)
LOC110524957 LOC106569957 other upstream 2843735 14988147 ~ 14995197 (-)
G371294 LOC106569911 other upstream 2974082 15123475 ~ 15124789 (-)

Expression


G368587 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G368587 Expression in each Bioproject

Bar chart with 20 bars.
G368587 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network