G367975



Basic Information


Item Value
gene id G367975
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 12237047 ~ 12237309 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU418235
TTTTGGCTCCATCCCATAACTGTACCATGGCACAGTGTGGGCTCCATTTCATAGTTTTTCACTTGTTTCATAGGGTCCATTGAGCCATAGATGAACATTGAGCCATAGATGAACAATCTCAATGCAATGTCATAATTACTTCTTGTTGACTGCAGGTGACTAAGTGCTGTATTAACTCCCATGAAGACCATTAGAACCGATTTACAGGAAACCGAACACAGTGGCTCCTGTGTTGTTCTGGACTCCTGTGTTGCGCTTATTAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU418235 True 263 lncRNA 0.43 1 12237047 12237309

Neighbor


gene id symbol gene type direction distance location
LOC110523206 ctxn3 coding upstream 102479 12113703 ~ 12134568 (+)
prrc1 prrc1 coding upstream 143655 12056952 ~ 12093392 (+)
megf10 megf10 coding upstream 185484 11947001 ~ 12051563 (+)
LOC110523202 NA coding upstream 314121 11919738 ~ 11922926 (+)
lmnb1 lmnb1 coding upstream 382215 11832909 ~ 11854832 (+)
LOC110523213 LOC106571108 coding downstream 79799 12317108 ~ 12321576 (+)
LOC110523216 LOC106570966 coding downstream 133601 12370910 ~ 12560586 (+)
nr5a1b LOC106570956 coding downstream 337270 12574579 ~ 12592217 (+)
psmb7 psmb7 coding downstream 389763 12627072 ~ 12647406 (+)
LOC110523223 LOC106570883 coding downstream 565523 12802832 ~ 12978339 (+)
G367969 NA non-coding upstream 10974 12225851 ~ 12226073 (+)
G367966 NA non-coding upstream 14954 12221861 ~ 12222093 (+)
G367960 NA non-coding upstream 24357 12212475 ~ 12212690 (+)
G367958 NA non-coding upstream 27176 12209661 ~ 12209871 (+)
G367954 NA non-coding upstream 31658 12205087 ~ 12205389 (+)
G367977 NA non-coding downstream 5633 12242942 ~ 12243209 (+)
slc12a2 nkcc1a non-coding downstream 21037 12180768 ~ 12261242 (+)
G367937 NA non-coding downstream 28063 12265372 ~ 12266052 (+)
G367987 LOC106571116 non-coding downstream 46930 12284239 ~ 12343442 (+)
G368039 NA non-coding downstream 131469 12368778 ~ 12369051 (+)
G367684 NA other upstream 357012 11878329 ~ 11880035 (+)
G366973 NA other upstream 808337 11425642 ~ 11428710 (+)
G366748 NA other upstream 1259895 10976682 ~ 10977152 (+)
G365197 NA other upstream 2387893 9848703 ~ 9849154 (+)
G364850 NA other upstream 3007816 9228838 ~ 9229231 (+)
G368440 NA other downstream 871387 13108696 ~ 13109134 (+)
G369763 NA other downstream 1527938 13765247 ~ 13769296 (+)
G370360 NA other downstream 2018494 14255803 ~ 14259133 (+)
G370382 smarcb1 other downstream 2083795 14321104 ~ 14325895 (+)
G370414 NA other downstream 2130363 14367672 ~ 14368161 (+)

Expression


G367975 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G367975 Expression in each Bioproject

Bar chart with 5 bars.
G367975 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network