G368854 (psmb7)


Basic Information

Item Value
gene id G368854
gene name psmb7
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 12645981 ~ 12647401 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU419232
GACTCAACGCAAACTTTATTTTAAACCATGGAAAAACATGCCATCTCCACTGAAGGAAGTAAAGGCGAATTTGGGAAGTAACAACGGGGAAAACATCAGAATGTTCCGGTGAGGCTTCAAGAGGTATCCATAGTCTGAACCGTCTCCTCAACCACCTCCAGATCCAATTTGATCACGGACTTCGTCAGGACTCCGGTTGTTCCTTGCTTGTACTTGTAATTACCGGTTCGGACACCCTTCTTGTTGGCCATGTCGTGAGGCCTCAGGTAGTCCACCCTGCCCTTGGTGATGACACACAGGTCAATGTTGCTGCCGGAGCCAAGGTCGTTGAAGATGCCAGCCGCAATGGCGTCCCGAACCAGCCGCTTGGCATCTTCCTCCTGAGGAGAGGAAAAACAACAATCATTATTGTAAACATGATCAATATCAT

Function

symbol description
psmb7 Predicted to enable kinase activity and threonine-type endopeptidase activity. Predicted to be involved in proteasomal protein catabolic process. Predicted to act upstream of or within phosphorylation and proteolysis involved in cellular protein catabolic process. Predicted to be located in cytoplasm. Predicted to be part of proteasome core complex, beta-subunit complex. Predicted to be active in nucleus. Orthologous to human PSMB7 (proteasome 20S subunit beta 7).

NR:

description
PREDICTED: proteasome subunit beta type-7 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU419232 True 430 lncRNA 0.48 2 12645981 12647401

Neighbor

gene id symbol gene type direction distance location
LOC110523215 znf79 coding downstream 280378 12362672 ~ 12365603 (-)
LOC118964561 LOC106571021 coding downstream 285820 12353415 ~ 12360161 (-)
LOC110523208 LOC106571116 coding downstream 296178 12341006 ~ 12349803 (-)
LOC110523210 LOC106571086 coding downstream 305334 12324608 ~ 12340647 (-)
LOC110523209 LOC106571116 coding downstream 332499 12302828 ~ 12313482 (-)
nek6 LOC106570951 coding upstream 529 12647930 ~ 12734470 (-)
LOC110523222 LOC106570907 coding upstream 134815 12782216 ~ 12795082 (-)
crb2a LOC106570879 coding upstream 337604 12985005 ~ 13026155 (-)
cdk9 cdk9 coding upstream 400517 13047918 ~ 13051933 (-)
crata LOC106570862 coding upstream 411486 13058887 ~ 13087209 (-)
LOC110523214 NA non-coding downstream 350223 12294889 ~ 12297815 (-)
G368704 NA non-coding downstream 384746 12258015 ~ 12261235 (-)
G368714 NA non-coding downstream 392548 12252379 ~ 12253433 (-)
G368715 NA non-coding downstream 398000 12247147 ~ 12247981 (-)
G368710 NA non-coding downstream 401771 12241305 ~ 12244210 (-)
G368910 NA non-coding upstream 30291 12677692 ~ 12684042 (-)
G368976 NA non-coding upstream 161366 12808767 ~ 12809226 (-)
G369075 NA non-coding upstream 270314 12917715 ~ 12918632 (-)
G369121 NA non-coding upstream 353426 13000827 ~ 13001212 (-)
G369132 NA non-coding upstream 374380 13021781 ~ 13023471 (-)
G368612 ctxn3 other downstream 509191 12134052 ~ 12136790 (-)
G365752 NA other downstream 3455883 9189669 ~ 9190098 (-)
G364754 NA other downstream 3595273 9047542 ~ 9099000 (-)
G364322 NA other downstream 4341798 8303267 ~ 8304183 (-)
LOC110524941 LOC106572051 other downstream 5920001 6562531 ~ 6726634 (-)
G368921 NA other upstream 58165 12705566 ~ 12706092 (-)
G370333 NA other upstream 1559789 14207190 ~ 14208705 (-)
G370635 NA other upstream 1779937 14427338 ~ 14428591 (-)
LOC110524957 LOC106569957 other upstream 2345727 14988147 ~ 14995197 (-)
G371294 LOC106569911 other upstream 2476074 15123475 ~ 15124789 (-)

Expression


Co-expression Network