G371170



Basic Information


Item Value
gene id G371170
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 15067025 ~ 15088540 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU421834
cctttatttaaccaggtaggctagttgagaacaagttctcatttgcaactgcgacctggccaagataaggcatagcagtgtgaacagacaacacagagttacacatggagtaaacaattaacacagtagaaaaaaggggagtctatatatacattgtgtgcaaaaggcatgagaaggtaggcaaataattacaattatgcagattaacactggagtgataaatgatcagatggttatgaacaggtagagatattggtgtgcaaaagagcagaaaaataaataaataaaaacagtatgggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU421834 True 300 lncRNA 0.37 2 15067025 15088540

Neighbor


gene id symbol gene type direction distance location
LOC110519479 LOC106596183 coding upstream 12672 15047739 ~ 15054353 (+)
LOC110523290 LOC106596183 coding upstream 32436 15027803 ~ 15034589 (+)
LOC110518391 LOC106596183 coding upstream 52413 15007790 ~ 15014612 (+)
dnlz dnlz coding upstream 67589 14995248 ~ 14999436 (+)
dolk dolk coding upstream 150347 14901565 ~ 14916678 (+)
uck1 LOC106569943 coding downstream 28684 15117198 ~ 15187954 (+)
LOC110523300 LOC105028392 coding downstream 376015 15464555 ~ 15591443 (+)
st6galnac4 st6galnac4 coding downstream 661651 15750191 ~ 15756190 (+)
st6galnac6 sia7f coding downstream 667719 15756259 ~ 15772026 (+)
LOC110523312 surf1 coding downstream 700255 15788795 ~ 15791028 (+)
G371159 NA non-coding upstream 10807 15015821 ~ 15056218 (+)
G371158 NA non-coding upstream 16089 15010816 ~ 15050936 (+)
G371113 NA non-coding upstream 93951 14972729 ~ 14973074 (+)
G371111 NA non-coding upstream 95235 14971481 ~ 14971790 (+)
G371101 NA non-coding upstream 104094 14962632 ~ 14962931 (+)
G371139 NA non-coding downstream 2427 15090967 ~ 15150407 (+)
G371206 NA non-coding downstream 104409 15192949 ~ 15193278 (+)
G371367 NA non-coding downstream 167562 15256102 ~ 15256318 (+)
G371420 NA non-coding downstream 258588 15347128 ~ 15347847 (+)
LOC118964542 LOC106569496 other upstream 261554 14798616 ~ 14805526 (+)
G370414 NA other upstream 698864 14367672 ~ 14368161 (+)
G370382 smarcb1 other upstream 741130 14321104 ~ 14325895 (+)
G370360 NA other upstream 807892 14255803 ~ 14259133 (+)
G371182 NA other downstream 35750 15124290 ~ 15128817 (+)
G371615 LOC100194725 other downstream 703019 15791559 ~ 15795122 (+)
G372281 LOC106569177 other downstream 1131066 16218328 ~ 16220933 (+)
G372373 NA other downstream 1647102 16735642 ~ 16738500 (+)
G372618 LOC105030512 other downstream 1781894 16870434 ~ 16882185 (+)

Expression


G371170 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G371170 Expression in each Bioproject

Bar chart with 7 bars.
G371170 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network