G372123



Basic Information


Item Value
gene id G372123
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 15978502 ~ 15981215 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU422973
atgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatacagggagcaccagtaccagatcaatgtggagctatatacagggagtaccaggtcaatgtggagctatatacagggggtaccagtaccatatcaatgtggagctatatacagggagtaccaggtcaatgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU422973 True 346 TUCP 0.45 2 15978502 15981215

Neighbor


gene id symbol gene type direction distance location
LOC110523317 LOC106568982 coding downstream 51859 15902216 ~ 15926643 (-)
LOC118964569 LOC106594099 coding downstream 79208 15898677 ~ 15899294 (-)
LOC118964568 LOC106568982 coding downstream 83324 15872778 ~ 15895178 (-)
c5h9orf78 cssa01h9orf78 coding downstream 163700 15810578 ~ 15814802 (-)
LOC118964750 NA coding downstream 182965 15795463 ~ 15795537 (-)
LOC118964745 NA coding upstream 222475 16203690 ~ 16205002 (-)
si:dkey-34e4.1 LOC106569177 coding upstream 237099 16218314 ~ 16410253 (-)
LOC110523325 LOC106569195 coding upstream 435766 16416981 ~ 16422022 (-)
LOC110522841 LOC106569125 coding upstream 446288 16427503 ~ 16430780 (-)
ppiab ppia1 coding upstream 492875 16474090 ~ 16479578 (-)
G372115 NA non-coding downstream 20905 15952602 ~ 15957597 (-)
G372113 NA non-coding downstream 37945 15939731 ~ 15940557 (-)
G372102 NA non-coding downstream 61457 15916550 ~ 15917045 (-)
G372063 LOC105015305 non-coding downstream 72274 15872828 ~ 15906228 (-)
G372093 NA non-coding downstream 108622 15869563 ~ 15869880 (-)
G372130 NA non-coding upstream 9435 15990650 ~ 15995471 (-)
G372139 NA non-coding upstream 28073 16009288 ~ 16009780 (-)
G372148 NA non-coding upstream 38896 16020111 ~ 16059536 (-)
G372155 NA non-coding upstream 49705 16030920 ~ 16031488 (-)
G372156 NA non-coding upstream 50497 16031712 ~ 16033430 (-)
G372122 NA other downstream 2386 15975606 ~ 15976116 (-)
LOC110523302 NA other downstream 280173 15693396 ~ 15707607 (-)
G371294 LOC106569911 other downstream 853713 15123475 ~ 15124789 (-)
LOC110524957 LOC106569957 other downstream 983343 14988147 ~ 14995197 (-)
G370635 NA other downstream 1549911 14427338 ~ 14428591 (-)
LOC110523341 LOC106569324 other upstream 953020 16909582 ~ 16942359 (-)
G373228 LOC106569424 other upstream 1142822 17124037 ~ 17125807 (-)
LOC110523354 LOC106569496 other upstream 1507811 17483696 ~ 17521507 (-)
G374189 NA other upstream 2021605 18002820 ~ 18003170 (-)
G374786 NA other upstream 2576925 18558140 ~ 18559167 (-)

Expression


G372123 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G372123 Expression in each Bioproject

Bar chart with 19 bars.
G372123 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network