G372255



Basic Information


Item Value
gene id G372255
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 16200783 ~ 16201146 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU423119
gtgatcttcctgtctgggttggcgcccccccttgggttgtgccgtggcggagatctttgtggactatactctgccttgtctcaggatggtaagttggtggttgaagatatccctctagtggtgtgggggctgcgctttggcaaagtgggtggggttatatccttcctgtttggctctgtccgggggtatcatcggatggggccacagtgtctcctgacccctcctgtctcagcctccagtatttatgctgcagtagtttatgtgttggggggctagggtcagtttgttatatctggagtacttctcctgtcttatccggtgtcctgtgtgaatttaagtatactctctctaattctctctttct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU423119 True 364 lncRNA 0.51 1 16200783 16201146

Neighbor


gene id symbol gene type direction distance location
ptges ptges coding upstream 342423 15852569 ~ 15858360 (+)
usp20 LOC106569850 coding upstream 361324 15816800 ~ 15839459 (+)
LOC118964570 NA coding upstream 369042 15829533 ~ 15831741 (+)
med22 med22 coding upstream 390281 15796177 ~ 15810502 (+)
LOC110523312 surf1 coding upstream 409755 15788795 ~ 15791028 (+)
LOC110523326 dusp26 coding downstream 233117 16434263 ~ 16437732 (+)
LOC110523327 LOC105015301 coding downstream 253449 16454595 ~ 16470342 (+)
pargl LOC106569224 coding downstream 315654 16516800 ~ 16557705 (+)
LOC110523336 NA coding downstream 489759 16690905 ~ 16694551 (+)
polm LOC106569276 coding downstream 511036 16712182 ~ 16726009 (+)
G371818 NA non-coding upstream 34979 16161694 ~ 16165804 (+)
G371819 NA non-coding upstream 35789 16163837 ~ 16164994 (+)
G371748 NA non-coding upstream 140360 16060013 ~ 16060423 (+)
G371743 NA non-coding upstream 145740 16054598 ~ 16055043 (+)
G371733 NA non-coding upstream 167917 16031679 ~ 16032866 (+)
G372270 NA non-coding downstream 9977 16211123 ~ 16211413 (+)
G372279 NA non-coding downstream 15526 16216672 ~ 16216871 (+)
G372281 LOC106569177 non-coding downstream 17182 16218328 ~ 16220933 (+)
G372288 NA non-coding downstream 46137 16247283 ~ 16247571 (+)
G372304 NA non-coding downstream 82011 16283157 ~ 16302922 (+)
G371615 LOC100194725 other upstream 405661 15791559 ~ 15795122 (+)
G371182 NA other upstream 1071966 15124290 ~ 15128817 (+)
LOC110519479 LOC106596183 other upstream 1147227 15047739 ~ 15054353 (+)
LOC118964542 LOC106569496 other upstream 1395312 14798616 ~ 14805526 (+)
G370414 NA other upstream 1832622 14367672 ~ 14368161 (+)
G372373 NA other downstream 534496 16735642 ~ 16738500 (+)
G372618 LOC105030512 other downstream 669288 16870434 ~ 16882185 (+)
G373726 NA other downstream 1502967 17704113 ~ 17707757 (+)
arhgef28a LOC106568988 other downstream 1866297 18067350 ~ 18177035 (+)

Expression


G372255 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G372255 Expression in each Bioproject

Bar chart with 18 bars.
G372255 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network