G373294



Basic Information


Item Value
gene id G373294
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 17245912 ~ 17246427 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU424416
ttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtgggcacgatgtgttcagggtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacgtgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgattagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatg

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU424416 True 516 lncRNA 0.46 1 17245912 17246427
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523353 LOC106569485 coding upstream 3001 17235812 ~ 17242911 (+)
LOC110523352 LOC106569472 coding upstream 28726 17191416 ~ 17217186 (+)
LOC100136246 LOC106569430 coding upstream 98134 17126356 ~ 17147778 (+)
atp5fa1 LOC106569424 coding upstream 120135 17119787 ~ 17125777 (+)
LOC110522812 loxhd1 coding upstream 174373 17019587 ~ 17071539 (+)
tnpo1 LOC106569531 coding downstream 481094 17727521 ~ 17778710 (+)
LOC110523357 LOC106569536 coding downstream 545433 17791860 ~ 17871592 (+)
LOC110523359 LOC106569632 coding downstream 631190 17877617 ~ 17879225 (+)
tmem174 LOC106569163 coding downstream 654066 17900493 ~ 17930164 (+)
btf3 btf3 coding downstream 794276 18040703 ~ 18047631 (+)
G373293 NA non-coding upstream 110 17245385 ~ 17245802 (+)
G373157 NA non-coding upstream 8507 17236769 ~ 17237405 (+)
G373144 NA non-coding upstream 15632 17172353 ~ 17230280 (+)
G373143 NA non-coding upstream 74295 17171400 ~ 17171617 (+)
G373137 NA non-coding upstream 83854 17161620 ~ 17162058 (+)
G373317 NA non-coding downstream 18739 17265166 ~ 17265396 (+)
G373353 NA non-coding downstream 44108 17290535 ~ 17290797 (+)
G373364 NA non-coding downstream 52536 17298963 ~ 17299314 (+)
G373387 NA non-coding downstream 83178 17329605 ~ 17329776 (+)
G373412 NA non-coding downstream 93670 17340097 ~ 17340358 (+)
G372618 LOC105030512 other upstream 363727 16870434 ~ 16882185 (+)
G372373 NA other upstream 507412 16735642 ~ 16738500 (+)
G372281 LOC106569177 other upstream 1024979 16218328 ~ 16220933 (+)
G371615 LOC100194725 other upstream 1450790 15791559 ~ 15795122 (+)
G371182 NA other upstream 2117095 15124290 ~ 15128817 (+)
G373726 NA other downstream 457686 17704113 ~ 17707757 (+)
arhgef28a LOC106568988 other downstream 821016 18067350 ~ 18177035 (+)
G376320 NA other downstream 2736834 19983261 ~ 19983848 (+)
G377022 NA other downstream 3345053 20591480 ~ 20596863 (+)
LOC110522816 LOC106568602 other downstream 3497157 20508074 ~ 20759255 (+)

Expression


G373294 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G373294 Expression in each Bioproject

Bar chart with 19 bars.
G373294 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network