G373796



Basic Information


Item Value
gene id G373796
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 17789132 ~ 17789428 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU424979
caggggtttgaggtaattgaggtagatacagaatataccatttgtattagccccatgtgccgaatacaacagtgaaatgcttacttatgagctgctaaccaacaatgcaattgaacaaaaatacagataagaaataaaagtaacaagtaattaaagagcagcagtaaaataacaatagcgagactatatacaggggggtaccggttagttgaagtaatatgtacatgtaggtagagtttttaaagtgactatgcatggataacaacaaagagtagcagcagtgtaaaatagaggggg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU424979 True 297 lncRNA 0.36 1 17789132 17789428

Neighbor


gene id symbol gene type direction distance location
tnpo1 LOC106569531 coding upstream 10422 17727521 ~ 17778710 (+)
LOC110523353 LOC106569485 coding upstream 546221 17235812 ~ 17242911 (+)
LOC110523352 LOC106569472 coding upstream 571946 17191416 ~ 17217186 (+)
LOC100136246 LOC106569430 coding upstream 641354 17126356 ~ 17147778 (+)
atp5fa1 LOC106569424 coding upstream 663355 17119787 ~ 17125777 (+)
LOC110523357 LOC106569536 coding downstream 2432 17791860 ~ 17871592 (+)
LOC110523359 LOC106569632 coding downstream 88189 17877617 ~ 17879225 (+)
tmem174 LOC106569163 coding downstream 111065 17900493 ~ 17930164 (+)
btf3 btf3 coding downstream 251275 18040703 ~ 18047631 (+)
arhgef28a LOC106568988 coding downstream 277922 18067350 ~ 18177035 (+)
G373792 NA non-coding upstream 2381 17786537 ~ 17786751 (+)
G373790 NA non-coding upstream 8991 17778908 ~ 17780141 (+)
G373788 NA non-coding upstream 23675 17764702 ~ 17765457 (+)
G373786 NA non-coding upstream 33549 17755140 ~ 17755583 (+)
G373797 NA non-coding downstream 88 17789516 ~ 17789847 (+)
G373833 NA non-coding downstream 93922 17883350 ~ 17887537 (+)
G373848 NA non-coding downstream 123052 17912480 ~ 17954790 (+)
G374094 NA non-coding downstream 213396 18002824 ~ 18003153 (+)
G374095 NA non-coding downstream 220684 18010112 ~ 18010381 (+)
G373726 NA other upstream 81375 17704113 ~ 17707757 (+)
G372618 LOC105030512 other upstream 906947 16870434 ~ 16882185 (+)
G372373 NA other upstream 1050632 16735642 ~ 16738500 (+)
G372281 LOC106569177 other upstream 1568199 16218328 ~ 16220933 (+)
G371615 LOC100194725 other upstream 1994010 15791559 ~ 15795122 (+)
G376320 NA other downstream 2193833 19983261 ~ 19983848 (+)
G377022 NA other downstream 2802052 20591480 ~ 20596863 (+)
LOC110522816 LOC106568602 other downstream 2954156 20508074 ~ 20759255 (+)
LOC110522817 LOC106568462 other downstream 3041830 20831111 ~ 20842676 (+)

Expression


G373796 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G373796 Expression in each Bioproject

Bar chart with 20 bars.
G373796 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network