G376320



Basic Information


Item Value
gene id G376320
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 19983261 ~ 19983848 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU427802
gcccactgaatgccgctcgttcctcacccagtgtgatattgtgttttctctccagcccaacacttactccaggagcactgctcgtatcgcctacgtcatatctctccttactggacgggctcgtgagtggggcacggcaatctgggaggcaagggctgagtgtactaaccagtatcaggactttaaggaggagatgatacgggtttttgatcgatctgtttttggggaggaggcttccagggtcctgtcttccctatgtcaaggtaatcgatccataacagactactctattgagtttcgcactcttgctgtctccagtggctggaacgagccggctttgctcgctcgttttctggagggtctccgcgcagaggtaaaggatgagattctctcccgggaggttccttccagcgtggattccttgattgaactcgctattcgcattgagcgacgggttgatcttcgtcaccgagctcgtggaaaggagctcgcgttctccgttgcccccctctccgcatcactaccatcttcctctgccggctcgggtgctgagcctatgcagctgggaggtatccgcatctcgactaa

Function


NR:

description
Retrotransposon-derived protein PEG10

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU427802 True 588 TUCP 0.54 1 19983261 19983848

Neighbor


gene id symbol gene type direction distance location
LOC110523383 LOC106568686 coding upstream 474196 19499604 ~ 19512291 (+)
LOC110523377 LOC106568724 coding upstream 619172 19358271 ~ 19364089 (+)
LOC110523370 fa69b coding upstream 1405033 18558152 ~ 18578228 (+)
egfl7 LOC106568866 coding upstream 1477119 18487620 ~ 18506142 (+)
LOC110523366 nsa2 coding upstream 1561003 18415774 ~ 18422258 (+)
LOC110523391 LOC106568645 coding downstream 67545 20051393 ~ 20381619 (+)
LOC110523393 LOC106568920 coding downstream 406682 20390530 ~ 20414156 (+)
LOC110522816 LOC106568602 coding downstream 524226 20508074 ~ 20759255 (+)
LOC110522817 LOC106568462 coding downstream 847263 20831111 ~ 20842676 (+)
pnx LOC106568480 coding downstream 874494 20858342 ~ 20859762 (+)
G376319 NA non-coding upstream 223 19982793 ~ 19983038 (+)
G376287 NA non-coding upstream 32970 19950076 ~ 19950291 (+)
G376267 NA non-coding upstream 56440 19926621 ~ 19926821 (+)
G376250 NA non-coding upstream 65105 19917851 ~ 19918156 (+)
G375980 NA non-coding upstream 170757 19805729 ~ 19812504 (+)
G376321 LOC107579696 non-coding downstream 803 19984651 ~ 19984987 (+)
G376322 NA non-coding downstream 2946 19986794 ~ 19987027 (+)
G376323 NA non-coding downstream 3664 19987512 ~ 19991060 (+)
G376326 NA non-coding downstream 8829 19992677 ~ 19993109 (+)
G376330 NA non-coding downstream 14492 19998340 ~ 19998596 (+)
arhgef28a LOC106568988 other upstream 1899896 18067350 ~ 18177035 (+)
G373726 NA other upstream 2275504 17704113 ~ 17707757 (+)
G372618 LOC105030512 other upstream 3101076 16870434 ~ 16882185 (+)
G372373 NA other upstream 3244761 16735642 ~ 16738500 (+)
G372281 LOC106569177 other upstream 3762328 16218328 ~ 16220933 (+)
G377022 NA other downstream 607632 20591480 ~ 20596863 (+)
LOC110523400 LOC106568542 other downstream 1124321 21108129 ~ 21160149 (+)
G378660 NA other downstream 2188687 22172535 ~ 22231920 (+)

Expression


G376320 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G376320 Expression in each Bioproject

Bar chart with 18 bars.
G376320 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network