G376536



Basic Information


Item Value
gene id G376536
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 20310816 ~ 20335580 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU428038
tgcgcttttgacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagggagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaatacagttttatatctttatgtttgaagcctgaaatgtggcaaaaggtcgcaaagttcaagagggccgaatacttttgcaa

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU428038 True 374 lncRNA 0.38 2 20310816 20335580
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523383 LOC106568686 coding upstream 801751 19499604 ~ 19512291 (+)
LOC110523377 LOC106568724 coding upstream 946727 19358271 ~ 19364089 (+)
LOC110523370 fa69b coding upstream 1732588 18558152 ~ 18578228 (+)
egfl7 LOC106568866 coding upstream 1804674 18487620 ~ 18506142 (+)
LOC110523366 nsa2 coding upstream 1888558 18415774 ~ 18422258 (+)
LOC110523393 LOC106568920 coding downstream 54950 20390530 ~ 20414156 (+)
LOC110522816 LOC106568602 coding downstream 172494 20508074 ~ 20759255 (+)
LOC110522817 LOC106568462 coding downstream 495531 20831111 ~ 20842676 (+)
pnx LOC106568480 coding downstream 522762 20858342 ~ 20859762 (+)
LOC110522818 LOC106568484 coding downstream 546358 20881938 ~ 20897867 (+)
G376503 NA non-coding upstream 13206 20272658 ~ 20297610 (+)
G376499 NA non-coding upstream 43657 20266886 ~ 20267159 (+)
G376471 NA non-coding upstream 84050 20221936 ~ 20226766 (+)
G376454 NA non-coding upstream 121435 20188776 ~ 20189381 (+)
G376330 NA non-coding upstream 312220 19998340 ~ 19998596 (+)
G376857 NA non-coding downstream 48446 20384026 ~ 20384324 (+)
G376859 NA non-coding downstream 51700 20387280 ~ 20387705 (+)
G376862 NA non-coding downstream 52685 20388265 ~ 20388600 (+)
G376864 NA non-coding downstream 53925 20389505 ~ 20389755 (+)
G376867 NA non-coding downstream 85350 20420930 ~ 20421730 (+)
G376320 NA other upstream 326968 19983261 ~ 19983848 (+)
arhgef28a LOC106568988 other upstream 2227451 18067350 ~ 18177035 (+)
G373726 NA other upstream 2603059 17704113 ~ 17707757 (+)
G372618 LOC105030512 other upstream 3428631 16870434 ~ 16882185 (+)
G372373 NA other upstream 3572316 16735642 ~ 16738500 (+)
G377022 NA other downstream 255900 20591480 ~ 20596863 (+)
LOC110523400 LOC106568542 other downstream 772589 21108129 ~ 21160149 (+)
G378660 NA other downstream 1836955 22172535 ~ 22231920 (+)

Expression


G376536 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G376536 Expression in each Bioproject

Bar chart with 18 bars.
G376536 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network