G382689



Basic Information


Item Value
gene id G382689
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 25806737 ~ 25815563 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU434853
gctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgaattttttccccattcctccttgcaaaacagctcgagctcagggaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgtttgaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacattttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttctttttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcctctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgtacttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtca

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU434853 True 1080 lncRNA 0.44 2 25806737 25815563
Loading

Neighbor


gene id symbol gene type direction distance location
cacna1b cacna1b coding upstream 13738 25672900 ~ 25793763 (+)
LOC110523494 NA coding upstream 245724 25528909 ~ 25561013 (+)
LOC110523493 LOC106567525 coding upstream 323948 25473913 ~ 25482789 (+)
aqp3b LOC106567539 coding upstream 382511 25419705 ~ 25424226 (+)
trnaa-ugc-10 NA coding upstream 1087306 24719360 ~ 24719431 (+)
LOC110523500 LOC106567252 coding downstream 54180 25869743 ~ 25938520 (+)
LOC110522854 LOC106563131 coding downstream 136531 25952094 ~ 25955508 (+)
whrna LOC106567256 coding downstream 180085 25995648 ~ 26149621 (+)
LOC118964579 LOC106567353 coding downstream 346520 26162083 ~ 26166903 (+)
LOC110523503 NA coding downstream 359321 26174884 ~ 26186710 (+)
G382652 NA non-coding upstream 11327 25794101 ~ 25795410 (+)
G382673 NA non-coding upstream 24126 25782396 ~ 25782611 (+)
G382670 NA non-coding upstream 30920 25775600 ~ 25775817 (+)
G382598 NA non-coding upstream 181872 25624113 ~ 25624865 (+)
G382795 NA non-coding downstream 164838 25980401 ~ 25980628 (+)
G382895 NA non-coding downstream 299462 26115025 ~ 26471390 (+)
G382811 NA non-coding downstream 337062 26152625 ~ 26153458 (+)
G382815 NA non-coding downstream 351639 26167202 ~ 26168148 (+)
G382925 NA non-coding downstream 375471 26191034 ~ 26199874 (+)
G382186 NA other upstream 581007 25225442 ~ 25225730 (+)
G381239 NA other upstream 1030308 24687739 ~ 24776429 (+)
LOC110523468 vamp5 other upstream 1962392 23838502 ~ 23844345 (+)
G380340 NA other upstream 2065278 23740434 ~ 23741459 (+)
LOC110522832 LOC106567816 other upstream 2169646 23623921 ~ 23678038 (+)
LOC110522865 LOC106567246 other downstream 622056 26437517 ~ 26502284 (+)
G383794 LOC106566282 other downstream 846275 26661838 ~ 26663613 (+)
LOC110522888 LOC106566402 other downstream 1859789 27675352 ~ 27719165 (+)
G385053 NA other downstream 1891151 27706714 ~ 27707078 (+)

Expression


G382689 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G382689 Expression in each Bioproject

Bar chart with 20 bars.
G382689 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network