G394268



Basic Information


Item Value
gene id G394268
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 35237888 ~ 35238087 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU447365
ataggcaagatacagtagatggtatcgggtacagtatgtacaaatgagatgagtatgtaaacaaagtggcatagtatagtataaagtggctagtgatacatgtattacataaggataccgtcgatgacatagagtacagtatatacgtatgcatatgagatgaataatgtagggtaagtaacatttatataaggtagcat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU447365 True 200 lncRNA 0.34 1 35237888 35238087
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523660 LOC106565209 coding upstream 38897 35086826 ~ 35206863 (+)
adra1ab LOC106565247 coding upstream 789096 34436786 ~ 34448792 (+)
si:ch211-127i16.2 LOC106565287 coding upstream 1090562 34107180 ~ 34147326 (+)
LOC110523649 LOC106565324 coding upstream 1148904 33846773 ~ 34088984 (+)
trnaa-ugc-11 NA coding upstream 1205048 34032765 ~ 34032840 (+)
si:dkey-242g16.2 LOC106565196 coding downstream 116011 35354098 ~ 35357244 (+)
stoml2 stml2 coding downstream 229853 35467940 ~ 35480670 (+)
LOC118964586 LOC106565090 coding downstream 244141 35482228 ~ 35542795 (+)
unc13bb LOC106565090 coding downstream 308458 35546545 ~ 35595618 (+)
atp8b5b LOC106565083 coding downstream 364514 35602601 ~ 35620548 (+)
G394147 NA non-coding upstream 41389 35196282 ~ 35196499 (+)
G394142 NA non-coding upstream 47089 35190187 ~ 35190799 (+)
G394137 NA non-coding upstream 58163 35179504 ~ 35179725 (+)
G394131 NA non-coding upstream 68602 35169057 ~ 35169286 (+)
G394286 NA non-coding downstream 11178 35249265 ~ 35249491 (+)
G394291 NA non-coding downstream 14240 35252327 ~ 35252557 (+)
G394297 NA non-coding downstream 16704 35254791 ~ 35255120 (+)
G394312 NA non-coding downstream 25000 35263087 ~ 35263357 (+)
G394320 NA non-coding downstream 30956 35269043 ~ 35269640 (+)
G392776 NA other upstream 1089187 34147474 ~ 34150795 (+)
G391805 NA other upstream 1876547 33360957 ~ 33361341 (+)
G391513 LOC100136561 other upstream 2074908 33158826 ~ 33162980 (+)
G390393 NA other upstream 3017355 32220181 ~ 32220533 (+)
G390184 NA other upstream 3277143 31960355 ~ 31960745 (+)
G394882 NA other downstream 667025 35905112 ~ 35905781 (+)
G394910 NA other downstream 728850 35966937 ~ 36004829 (+)
you2 you2 other downstream 795173 36033260 ~ 36034806 (+)
G395005 LOC106564805 other downstream 964814 36202901 ~ 36206616 (+)
G395034 NA other downstream 1042213 36280300 ~ 36301290 (+)

Expression


G394268 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G394268 Expression in each Bioproject

Bar chart with 5 bars.
G394268 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network