G397279



Basic Information


Item Value
gene id G397279
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 37852573 ~ 37858816 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU450786
ctgttacggtgcgtgaatgaggacccaaaagcgaattaacttaaacagagcttctttaattaccaaacataggtaggctcagacggaccggcagattccgacaggacaggacaaggttacagcaaacatgacgacagtctggttcaggcatgaaacacaacaaacaagaatccgacaaggacaggaacaaaaacagagagagatataggggactaatcagagggaaaaagggaacaggtgggaaaaggggtgacgaggtggttaggaggagacaaggcacagctgggggaaagagggggagaaaaggtaacctaacaacgaccagcagagggagacagggtgaagggaaaggacagagacaagacacaacatgacagtacatgacaattcctcctgacagagttggtgtatctgagtcaagtttgtaggcctccttgcacgcacacgctttttcagttctgcccacaaattttctataggattgaggtcagggctttttgatggccactccaataccttgactttcttgtccttaagccattttcccatgactttggaagtatgcttggggtcattgtccatttggatgacccatttgcctaccaagctttaacttcctgactgatgtcttgagatgttgcttcaatatatccacatacttttccatcctcatgatgccatctattttgtgaagtgcacgagaccctcctgcagcaaagcacccccacaacatgatgctgccacccccatgcttcacggttgggatggtgttctttggcttgcaagcctccccctttttcctccaaacataacgatgggcattatggccaaaaagttatatttttgtttcatcagaccagaggatatgtctccaaaaagtatgatctttgtccccagttgcaaaccgtagtctggctttcttattgtggttttggagcagtggcttcttccagcatcttcacaaggtcctttgctgttgatctgagattgatttgcactttttgcaccaaagtacgttcatttctaggtgacagaacgcgtctcctttctgagcagtatgacggctgtgtggtcccatggtatttatacttgcatactattgtttgtacagatgaacgtggtaccttcaggcgtttggaaattgctcccaaggatgaaccagacttgtggaggtctacaatttttttttctgaggtcttggctgatttcttttgattttcccatgatgtcaagcaaagagggactgagtttgaaggtagtccttgacatacatccacaggtacacctccaattgactcaaatgatgtcaattagcccatcagaagcttctgaagccataacatcattttctggaatttcccaagctgtttaaaggtactgtcaacttagtgtatgtaaacttctgacccactggaattgtgataaagtgaattgtaaatgaaataatctgtctgtaaacaattgttggaaaaatgacttgtgtcacgcacaaaggagatgtcctaaccgacttgccaaaactagtttgttaacaagaaatttgtggagtggttgaaaaattagttttaatgactccagcctaagtg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU450786 True 1586 lncRNA 0.44 2 37852573 37858816

Neighbor


gene id symbol gene type direction distance location
LOC110523752 LOC106564266 coding downstream 266763 37576263 ~ 37585810 (-)
zmat5 zmat5 coding downstream 289412 37558291 ~ 37563161 (-)
LOC118964587 NA coding downstream 323080 37526816 ~ 37530248 (-)
tescb LOC106564304 coding downstream 407375 37421164 ~ 37445198 (-)
LOC110523734 LOC106564312 coding downstream 529264 37294773 ~ 37323309 (-)
triap1 LOC106568193 coding upstream 62639 37921455 ~ 37923744 (-)
sgsm1b LOC106564180 coding upstream 64024 37922840 ~ 37943931 (-)
LOC110523760 LOC106564165 coding upstream 126142 37984958 ~ 38018439 (-)
LOC110523764 pgam5 coding upstream 335216 38194032 ~ 38200413 (-)
gdnfa gdnf coding upstream 460243 38318608 ~ 38329072 (-)
G397166 NA non-coding downstream 159631 37691897 ~ 37692942 (-)
G397105 NA non-coding downstream 262359 37589920 ~ 37590214 (-)
G397096 NA non-coding downstream 282284 37569949 ~ 37570289 (-)
G397093 NA non-coding downstream 295965 37556202 ~ 37556608 (-)
G397090 NA non-coding downstream 303513 37546714 ~ 37549060 (-)
G397316 LOC106564195 non-coding upstream 103368 37962184 ~ 37964728 (-)
G397333 NA non-coding upstream 109166 37967982 ~ 37968204 (-)
G397334 NA non-coding upstream 109517 37968333 ~ 37968763 (-)
G397335 NA non-coding upstream 110800 37969616 ~ 37970071 (-)
G397094 NA other downstream 246532 37603796 ~ 37606041 (-)
G396446 setd1b other downstream 780449 37071006 ~ 37072124 (-)
G395600 NA other downstream 1405122 36446978 ~ 36447451 (-)
G395546 NA other downstream 1437658 36414122 ~ 36414915 (-)
G395525 NA other downstream 1550581 36301466 ~ 36301992 (-)
G397378 NA other upstream 207459 38066275 ~ 38069974 (-)
G397500 cssa01h5orf42 other upstream 366165 38224981 ~ 38225520 (-)
G398487 NA other upstream 1265669 39124485 ~ 39125159 (-)
LOC110522860 LOC106565786 other upstream 1267719 39125473 ~ 39129083 (-)
capslb LOC106563770 other upstream 1665146 39522323 ~ 39525554 (-)

Expression


G397279 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G397279 Expression in each Bioproject

Bar chart with 21 bars.
G397279 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network