G406515



Basic Information


Item Value
gene id G406515
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 46079142 ~ 46096671 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU461174
aaaaaaaatccagaaagtcacattgtaggatttttaatgaatttgcaaattatggtggaaaataagtatttggtcaataacaaaagtttatctcaatactttgttatataccctttgttggcaatgacagaggtcaaacgttttctgtaagtcttcacaaggttttcacacattgttgctggtattttggcccattcatccatgcagatctcctctagagcagtgatgttttggggctgttgctgggcaacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU461174 True 253 lncRNA 0.36 2 46079142 46096671
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523950 LOC106561514 coding downstream 55565 46019698 ~ 46023840 (-)
LOC110523936 LOC106561621 coding downstream 607091 45342639 ~ 45472051 (-)
morn5 LOC106561708 coding downstream 1026900 45035746 ~ 45052242 (-)
LOC110522867 NA coding downstream 1085561 44970211 ~ 44993581 (-)
LOC110523925 LOC106562826 coding downstream 1145966 44915184 ~ 44933176 (-)
LOC110523952 LOC106568444 coding upstream 38741 46135412 ~ 46171517 (-)
LOC110523954 plgrkt coding upstream 205141 46301812 ~ 46322518 (-)
LOC110523958 ermp1 coding upstream 314285 46410956 ~ 46450430 (-)
LOC110523959 kiaa2026 coding upstream 371364 46468035 ~ 46480496 (-)
LOC110522868 NA coding upstream 391744 46488415 ~ 46491943 (-)
G406155 NA non-coding downstream 11100 46067804 ~ 46068042 (-)
G406076 LOC100136563 non-coding downstream 89659 45977280 ~ 45989483 (-)
G406077 lcn2 non-coding downstream 96920 45977432 ~ 45982222 (-)
G406072 NA non-coding downstream 147686 45930040 ~ 45931456 (-)
G406062 NA non-coding downstream 161498 45917426 ~ 45917644 (-)
G406566 NA non-coding upstream 75138 46171809 ~ 46172156 (-)
G406574 NA non-coding upstream 100716 46197387 ~ 46202512 (-)
G406654 NA non-coding upstream 239129 46335800 ~ 46338550 (-)
G406774 NA non-coding upstream 447408 46544079 ~ 46544458 (-)
oaz1b oaz1b non-coding upstream 452477 46549148 ~ 46561361 (-)
G405889 LOC106561608 other downstream 466187 45612428 ~ 45612955 (-)
G405871 NA other downstream 492959 45585648 ~ 45586183 (-)
G405292 LOC106561687 other downstream 886675 45191532 ~ 45192467 (-)
G406588 NA other upstream 122996 46219667 ~ 46234537 (-)
LOC110523962 LOC106561388 other upstream 507558 46572673 ~ 46610314 (-)
G408664 NA other upstream 2125281 48221952 ~ 48223220 (-)
G408782 sec16a other upstream 2256631 48353302 ~ 48357565 (-)
G410168 NA other upstream 3437245 49533916 ~ 49576456 (-)

Expression


G406515 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G406515 Expression in each Bioproject

Bar chart with 17 bars.
G406515 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network