G408667



Basic Information


Item Value
gene id G408667
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 48256292 ~ 48279779 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU463582
agaattctaccactgaacaaccaatgccttggaaggctgagttaacctcaaaggcaggaaattgtatcataaagctttttttccaagaatatgttccactttgtgggctcagcaacattattcaccctaaaaaaagagctgtactttctccccgtcggggaattgaaccccggtctcccgcgtgacaggcggggatactcaccactatactaacgaggagcaggtgggttggggctttgaaaaaacgtggagcattggtactaaccctaaatttggactgttgggcttaaacccttctaacaaaaatatctgtagagactgaatggttggagctaggaactactatgaccccgctatggaaagctgagactctcacaaacacgtacatgtaatcgattttgctctataccgctcacaagccacacaatactagtttgcaggtgaggcgtttgtgggtaatcccaggacattgtcacaaatgccaaactcaagac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU463582 True 494 lncRNA 0.45 2 48256292 48279779
Loading

Neighbor


gene id symbol gene type direction distance location
nup54 nup54 coding downstream 130614 48106327 ~ 48125678 (-)
LOC110523978 LOC106605670 coding downstream 226616 48027781 ~ 48029676 (-)
LOC110523975 NA coding downstream 346047 47826801 ~ 47910245 (-)
LOC118964754 NA coding downstream 560610 47695630 ~ 47695682 (-)
LOC110523973 ctif coding downstream 593622 47530422 ~ 47662670 (-)
LOC110523983 LOC106560666 coding upstream 145086 48423554 ~ 48489102 (-)
pdcl pdcl coding upstream 260303 48540082 ~ 48544432 (-)
pdxp plpp coding upstream 294971 48574750 ~ 48580663 (-)
mier3a LOC105008092 coding upstream 367127 48646906 ~ 48693022 (-)
LOC110523989 LOC106560554 coding upstream 450204 48729983 ~ 48847550 (-)
G408669 NA non-coding downstream 458 48230165 ~ 48255834 (-)
G408665 NA non-coding downstream 29436 48223300 ~ 48226856 (-)
G408666 NA non-coding downstream 35800 48220274 ~ 48220492 (-)
G408663 NA non-coding downstream 37833 48218126 ~ 48218459 (-)
G408662 NA non-coding downstream 38227 48217472 ~ 48218065 (-)
G408678 NA non-coding upstream 68421 48348200 ~ 48349152 (-)
G408787 NA non-coding upstream 80638 48360417 ~ 48360742 (-)
G408817 NA non-coding upstream 116969 48396748 ~ 48397100 (-)
G408820 NA non-coding upstream 120243 48400022 ~ 48401091 (-)
G408821 NA non-coding upstream 121386 48401165 ~ 48401479 (-)
G408664 NA other downstream 33072 48221952 ~ 48223220 (-)
LOC110523962 LOC106561388 other downstream 1646177 46572673 ~ 46610314 (-)
G406588 NA other downstream 2021755 46219667 ~ 46234537 (-)
LOC110523950 LOC106561514 other downstream 2232452 46019698 ~ 46023840 (-)
G406076 LOC100136563 other downstream 2266809 45977280 ~ 45989483 (-)
G408782 sec16a other upstream 73523 48353302 ~ 48357565 (-)
G410168 NA other upstream 1254137 49533916 ~ 49576456 (-)
G411459 NA other upstream 2339112 50618891 ~ 50619175 (-)
G411929 NA other upstream 2442535 50722314 ~ 50723061 (-)
G411930 NA other upstream 2443380 50723159 ~ 50724077 (-)

Expression


G408667 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G408667 Expression in each Bioproject

Bar chart with 9 bars.
G408667 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network