G408873



Basic Information


Item Value
gene id G408873
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 48509537 ~ 48509835 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU463827
TGCTTATATTGAGGACATACGGAGGCAAAAAGAGTTGGAGCAAAGTATTTGTGCCTAATTGTGAACAACAGGAAAGTCTGTCCTCTTGGGTCATCAAGATAAACGTGGTTATTTTTCCACTTGAAGTAGATATTGTAATCACACATCTTCCGCTGCAGGAAACAGTCTAGAACAAACCCTTGTTGTAGCCTTTAGAGGACTAACGGAATAACTTATAGTTGTGATCCGCAGTAGACTGTTCATAAACATTTGTTCCACATTTTGGATGTTAATTTAATATTTGGTCTGCTGCTTTGTTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU463827 True 299 lncRNA 0.38 1 48509537 48509835
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523983 LOC106560666 coding downstream 61649 48423554 ~ 48489102 (-)
nup54 nup54 coding downstream 383859 48106327 ~ 48125678 (-)
LOC110523978 LOC106605670 coding downstream 479861 48027781 ~ 48029676 (-)
LOC110523975 NA coding downstream 599292 47826801 ~ 47910245 (-)
LOC118964754 NA coding downstream 813855 47695630 ~ 47695682 (-)
pdcl pdcl coding upstream 30247 48540082 ~ 48544432 (-)
pdxp plpp coding upstream 64915 48574750 ~ 48580663 (-)
mier3a LOC105008092 coding upstream 137071 48646906 ~ 48693022 (-)
LOC110523989 LOC106560554 coding upstream 220148 48729983 ~ 48847550 (-)
notch1 notch1 coding upstream 371558 48881393 ~ 48954869 (-)
G408855 rl28 non-coding downstream 24946 48481798 ~ 48484591 (-)
G408826 sec16a non-coding downstream 93803 48415341 ~ 48415734 (-)
G408825 NA non-coding downstream 94280 48414975 ~ 48415257 (-)
G408823 NA non-coding downstream 95552 48413254 ~ 48413985 (-)
G408875 NA non-coding upstream 3785 48513620 ~ 48513830 (-)
G408856 NA non-coding upstream 22587 48532422 ~ 48537040 (-)
G408891 NA non-coding upstream 35234 48545069 ~ 48545365 (-)
G408894 NA non-coding upstream 42389 48552224 ~ 48552468 (-)
G408895 NA non-coding upstream 43052 48552887 ~ 48553199 (-)
G408782 sec16a other downstream 151972 48353302 ~ 48357565 (-)
G408664 NA other downstream 286317 48221952 ~ 48223220 (-)
LOC110523962 LOC106561388 other downstream 1899422 46572673 ~ 46610314 (-)
G406588 NA other downstream 2275000 46219667 ~ 46234537 (-)
LOC110523950 LOC106561514 other downstream 2485697 46019698 ~ 46023840 (-)
G410168 NA other upstream 1024081 49533916 ~ 49576456 (-)
G411459 NA other upstream 2109056 50618891 ~ 50619175 (-)
G411929 NA other upstream 2212479 50722314 ~ 50723061 (-)
G411930 NA other upstream 2213324 50723159 ~ 50724077 (-)
LOC110524003 LOC106613485 other upstream 2669923 51179758 ~ 51228505 (-)

Expression


G408873 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G408873 Expression in each Bioproject

Bar chart with 15 bars.
G408873 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network