G409838



Basic Information


Item Value
gene id G409838
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 49648441 ~ 49648853 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU464883
cagacagacagtgacaacagaggaggactaggagaagcacagacagacagtgacaacagaggaggacaaggagaagcacagacagacagtgacaacagaggaggacaaggagaagcacagacagacagtgacaacagaggaggactaggagaagcacagacagacagtgacaacagaggaggacaaggagaagcacagacagacagtgacaacagaggaggactaggagaagcacagacagacagtgacaacagaggaggacaagaagaagcacagacagacagtgacaacagaggaggacaaggagaagcacagacagacagtgaaaacagaggaggacaaggagaagcacagacagacagtgaaaacagaggagaacacgatgaagcacagacagacagtgacaacagagg

Function


NR:

description
PREDICTED: protein HEG-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU464883 True 413 lncRNA 0.50 1 49648441 49648853

Neighbor


gene id symbol gene type direction distance location
LOC110522957 LOC106613948 coding upstream 124988 49521853 ~ 49523453 (+)
psmd5 psmd5 coding upstream 133996 49502161 ~ 49514445 (+)
setd9 setd9 coding upstream 1006773 48609741 ~ 48641668 (+)
LOC118964615 LOC106560613 coding upstream 1076023 48570174 ~ 48575010 (+)
rpl28 rl28 coding upstream 1161558 48478571 ~ 48486883 (+)
LOC110523995 LOC106560436 coding downstream 45370 49694223 ~ 49732545 (+)
LOC110522958 LOC106560427 coding downstream 87793 49736646 ~ 49742830 (+)
LOC110523996 hcn1 coding downstream 240664 49889400 ~ 50073258 (+)
nr5a2 LOC106613481 coding downstream 1080249 50729102 ~ 50825399 (+)
camsap2a camsap2 coding downstream 1410981 51059834 ~ 51153381 (+)
G409697 NA non-coding upstream 72011 49375269 ~ 49576430 (+)
G409792 NA non-coding upstream 103772 49544087 ~ 49544669 (+)
G409734 NA non-coding upstream 212594 49428331 ~ 49435847 (+)
G409667 NA non-coding upstream 307482 49335296 ~ 49340959 (+)
G409664 NA non-coding upstream 317807 49330338 ~ 49330634 (+)
G410343 NA non-coding downstream 91156 49740009 ~ 49740271 (+)
G410556 NA non-coding downstream 316628 49965481 ~ 49965926 (+)
G410561 NA non-coding downstream 324098 49972951 ~ 49973288 (+)
G410564 NA non-coding downstream 326234 49975087 ~ 49976601 (+)
G410593 NA non-coding downstream 358059 50006912 ~ 50007139 (+)
G409191 NA other upstream 666670 48948138 ~ 48981771 (+)
LOC110523980 LOC106560682 other upstream 1484554 48149869 ~ 48221948 (+)
G408222 NA other upstream 1609348 48036626 ~ 48039093 (+)
G408177 NA other upstream 1820966 47821590 ~ 47827475 (+)
G411519 NA other downstream 1014019 50662872 ~ 50663640 (+)
G412859 NA other downstream 2153397 51802250 ~ 51802820 (+)
G414007 NA other downstream 3112536 52761389 ~ 52761729 (+)

Expression


G409838 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G409838 Expression in each Bioproject

Bar chart with 9 bars.
G409838 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2500.
End of interactive chart.

Co-expression Network