G410556


Basic Information

Item Value
gene id G410556
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 49965481 ~ 49965926 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU465641
caggataccgaataggacaggagaagtactccagatataacaaactgaccctaaccccccgacacataaactactgcagcataaatactggaggctgagacaggaggggtcaggagacactgtggccccatccgaggacacccccggacagggccagacaggaaggatataaccccacccactttgccaaagcacagcccccacaccactagagggatatcttcaaccaccaacttaccatcctgagacaaggctgagtatagcccacaaagacctccgccacggcacaacccaaggggaggacgccaacccagacaggatgaccacatcagtgactcaacccactcaggtgacgcacccctcccagggacggtatgagagagccccagtaagccagtgactcagcccctgtaatagggttagaggcagagaatcccagtggaaag

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU465641 True 446 lncRNA 0.55 1 49965481 49965926
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110522958 LOC106560427 coding upstream 222651 49736646 ~ 49742830 (+)
LOC110523995 LOC106560436 coding upstream 232936 49694223 ~ 49732545 (+)
LOC110522957 LOC106613948 coding upstream 442028 49521853 ~ 49523453 (+)
psmd5 psmd5 coding upstream 451036 49502161 ~ 49514445 (+)
setd9 setd9 coding upstream 1323813 48609741 ~ 48641668 (+)
nr5a2 LOC106613481 coding downstream 763176 50729102 ~ 50825399 (+)
camsap2a camsap2 coding downstream 1093908 51059834 ~ 51153381 (+)
LOC110524004 LOC106613487 coding downstream 1317610 51283536 ~ 51291754 (+)
LOC118964752 NA coding downstream 1429651 51395577 ~ 51395631 (+)
LOC110524007 LOC106613489 coding downstream 1453504 51419430 ~ 51435491 (+)
G410343 NA non-coding upstream 225210 49740009 ~ 49740271 (+)
G409838 NA non-coding upstream 316628 49648441 ~ 49648853 (+)
G409697 NA non-coding upstream 389051 49375269 ~ 49576430 (+)
G409792 NA non-coding upstream 420812 49544087 ~ 49544669 (+)
G409734 NA non-coding upstream 529634 49428331 ~ 49435847 (+)
G410561 NA non-coding downstream 7025 49972951 ~ 49973288 (+)
G410564 NA non-coding downstream 9161 49975087 ~ 49976601 (+)
G410593 NA non-coding downstream 40986 50006912 ~ 50007139 (+)
G410598 NA non-coding downstream 48883 50014809 ~ 50015087 (+)
G410599 NA non-coding downstream 50368 50016294 ~ 50016552 (+)
LOC110523996 hcn1 other upstream 41883 49889400 ~ 50073258 (+)
G409191 NA other upstream 983710 48948138 ~ 48981771 (+)
LOC110523980 LOC106560682 other upstream 1801594 48149869 ~ 48221948 (+)
G408222 NA other upstream 1926388 48036626 ~ 48039093 (+)
G411519 NA other downstream 696946 50662872 ~ 50663640 (+)
G412859 NA other downstream 1836324 51802250 ~ 51802820 (+)
G414007 NA other downstream 2795463 52761389 ~ 52761729 (+)
G414041 NA other downstream 2812591 52778517 ~ 52779479 (+)

Expression

G410556 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G410556 Expression in each Bioproject

Bar chart with 19 bars.
G410556 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network