G410600



Basic Information


Item Value
gene id G410600
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 50019825 ~ 50020066 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU465686
gttctattaagccactatgcgcacgctccaggaaagctcgagccttccgctcctgcaactccctgagctgcgcctttagggttgcggatctctcccagtcaaacgacccgccgaggttgcctgcctcgtactcgagttcaattaacctttggatacgatccacctccctcctctcctccctttttttcctcttgcaataccctattataaaagccctaatcctcaccttaactaattcccac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU465686 True 242 lncRNA 0.52 1 50019825 50020066
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522958 LOC106560427 coding upstream 276995 49736646 ~ 49742830 (+)
LOC110523995 LOC106560436 coding upstream 287280 49694223 ~ 49732545 (+)
LOC110522957 LOC106613948 coding upstream 496372 49521853 ~ 49523453 (+)
psmd5 psmd5 coding upstream 505380 49502161 ~ 49514445 (+)
setd9 setd9 coding upstream 1378157 48609741 ~ 48641668 (+)
nr5a2 LOC106613481 coding downstream 709036 50729102 ~ 50825399 (+)
camsap2a camsap2 coding downstream 1039768 51059834 ~ 51153381 (+)
LOC110524004 LOC106613487 coding downstream 1263470 51283536 ~ 51291754 (+)
LOC118964752 NA coding downstream 1375511 51395577 ~ 51395631 (+)
LOC110524007 LOC106613489 coding downstream 1399364 51419430 ~ 51435491 (+)
G410599 NA non-coding upstream 3273 50016294 ~ 50016552 (+)
G410598 NA non-coding upstream 4738 50014809 ~ 50015087 (+)
G410593 NA non-coding upstream 12686 50006912 ~ 50007139 (+)
G410564 NA non-coding upstream 43224 49975087 ~ 49976601 (+)
G410561 NA non-coding upstream 46537 49972951 ~ 49973288 (+)
G410496 NA non-coding downstream 55386 50075452 ~ 50077843 (+)
G410808 NA non-coding downstream 83446 50103512 ~ 50104208 (+)
G410886 NA non-coding downstream 166758 50186824 ~ 50187035 (+)
G410911 NA non-coding downstream 185336 50205402 ~ 50205617 (+)
G410913 NA non-coding downstream 187055 50207121 ~ 50207339 (+)
LOC110523996 hcn1 other upstream 96227 49889400 ~ 50073258 (+)
G409191 NA other upstream 1038054 48948138 ~ 48981771 (+)
LOC110523980 LOC106560682 other upstream 1855938 48149869 ~ 48221948 (+)
G408222 NA other upstream 1980732 48036626 ~ 48039093 (+)
G411519 NA other downstream 642806 50662872 ~ 50663640 (+)
G412859 NA other downstream 1782184 51802250 ~ 51802820 (+)
G414007 NA other downstream 2741323 52761389 ~ 52761729 (+)
G414041 NA other downstream 2758451 52778517 ~ 52779479 (+)

Expression


G410600 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G410600 Expression in each Bioproject

Bar chart with 19 bars.
G410600 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network